Brutons tyrosine kinase and protein kinase c µ are required for TLR7 9 induced IKKα and IRF 1 activation and interferon β production in conventional dendritic cells
... PCR system using the following primers: IFN-b, 5’CAGCTCCAAGAAAGGACGAAC-3’ and 5’-GGCAGTGTAACTCTTCTGCAT-3’; b-actin, 59- AGATGACCCAGATCATGTTTGAGA- 39 and 59- CACAGCCTGGATGGCTACGTA- 39 Wild type C5 7BL/6 ... which PKC member is involved in TLR7/ 9- induced IFN-b production in CDC In this paper, we undertook to examine if both BTK and PKC are involved in TLR-7 /9 activ...
Ngày tải lên: 23/09/2015, 14:47
... 60 full-length splice variants, derived from the extracellular domains of the 21 type receptor genes, were confirmed to be novel – with variants from the c-Met protooncogene being the most diverse ... ASV derived from receptors that play key roles in angiogenesis – VEGFR1 and, for the first time, Tie1 – can reduce arthritis severity More broadly, ASV are a sourc...
Ngày tải lên: 09/08/2014, 10:23
... the contribution of the N- and C-terminal regions of GCPII to its enzymatic properties and structure /folding The results clearly show that the amino acids at the extreme C-terminus of GCPII are ... ATTCTCGAGTCATTAGGCTACTTCACTCAAAG AAACTCGAGAGATCTAAATCCTCCAATGAAGC ATTCTCGAGTCATTATGCAACATAAATCTGTCTCTT AAACTCGAGAGATCTAAATCCTCCAATGAAGC AAACTCGAGTTATTATTCAATATCAAA...
Ngày tải lên: 07/03/2014, 15:20
Báo cáo khoa học: Activation of p21-activated kinase 1 is required for lysophosphatidic acid-induced focal adhesion kinase phosphorylation and cell motility in human melanoma A2058 cells potx
... not inhibit the activation of PAK1 by LPA in A2058 cells PAK1 activation is required for LPA-induced FAK phosphorylation and motility LPA has been shown to increase phosphorylation of FAK in human ... cells, cells were pretreated with either tyrosine kinase inhibitor, genistein, or MAP kinase inhibitor, PD98059 Inhibition of tyrosine kinase by genist...
Ngày tải lên: 30/03/2014, 13:20
Tài liệu Báo cáo khoa học: Characterization of promoter 3 of the human thromboxane A2 receptor gene A functional AP-1 and octamer motif are required for basal promoter activity docx
... Prm3 was performed using the mutator primers Kin175 (5¢-CACCAGAGCTACTTACA CTGAATTCCAGAATAATCACAAGCAAATC -3 ; sense primer) vs its complement generating pGL3b:Prm3aOCT)1*, pGL3b:Prm3abOCT)1* and ... Prm3aaAP)1*, pGL3e:Prm3aaAP)1*, pGL3b:Prm3aaaAP)1* and pGL3e:Prm3aaaAP)1* Mutation of the Oct-1 element with the sequence aaA TGCa to aaTTCCa (core bases shown in uppercase letters) cen...
Ngày tải lên: 19/02/2014, 16:20
Báo cáo khoa học: Saccharomyces cerevisiae Ybr004c and its human homologue are required for addition of the second mannose during glycosylphosphatidylinositol precursor assembly ppt
... in Man2 addition to GPIs We conclude that human Ybr004cp is the functional equivalent of S cerevisiae Ybr004cp Discussion The majority of the steps in assembly and decoration of the GPI precursor ... protein (Ybr004cp) required for addition of the second mannose to GPI precursors Yeast cells depleted of Ybr004cp exhibit cell wall and morphological a...
Ngày tải lên: 07/03/2014, 16:20
Báo cáo khoa học: The sulfur atoms of the substrate CoA and the catalytic cysteine are required for a productive mode of substrate binding in bacterial biosynthetic thiolase, a thioester-dependent enzyme doc
... sulfur sulfur interactions in defining the catalytically competent binding mode of CoA in the active site The pantetheine binding tunnel of biosynthetic thiolase When CoA binds to Z ramigera biosynthetic ... thiolase superfamily The results obtained indicate that the sulfur atoms of both the enzyme and the substrate are important for the...
Ngày tải lên: 16/03/2014, 04:20
Báo cáo Y học: DAP kinase activity is critical for C2-ceramide-induced apoptosis in PC12 cells ppt
... the intrinsic kinase activity of DAP kinase is critical for apoptosis The mechanism of DAP kinase activation has not been clear DAP kinase undergoes phosphorylation and the intrinsic activity is ... ®ndings clearly demonstrate that DAP kinase activity is critical for C2- and C8-ceramideinduced apoptosis in PC12 cells DISCUSSION DAP kinase i...
Ngày tải lên: 24/03/2014, 00:21
Báo cáo sinh học: " Transcription and translation of human F11R gene are required for an initial step of atherogenesis induced by inflammatory cytokines" doc
... article as: Azari et al.: Transcription and translation of human F11R gene are required for an initial step of atherogenesis induced by inflammatory cytokines Journal of Translational Medicine 2011 ... processes Conclusion We conclude that the transcription and translation of the human F11R gene are required initial steps of atherog...
Ngày tải lên: 18/06/2014, 19:20
báo cáo khoa học: " Plastid chaperonin proteins Cpn60α and Cpn60β are required for plastid division in Arabidopsis thaliana" docx
... ptCpn60α and ptCpn60β are required for proper FtsZ ring formation To confirm the reduction of ptCpn60β proteins in ptcpn60β mutants and further examine localization of the proteins, we prepared ... thaliana proteins with cyanobacterial chaperonin 60 proteins (Figure 2) Of these, two proteins, including At2g28000, were grouped as ptCpn60α (we named them ptCpn60α1 and pt...
Ngày tải lên: 12/08/2014, 03:20
Báo cáo y học: "Two discrete events, human T-cell leukemia virus type I Tax oncoprotein expression and a separate stress stimulus, are required for induction of apoptosis in T-cells" pptx
... NF-kappaB in apoptosis- resistant T-cell transfectants with Tax J Virol 1999, 73:7981-7987 Kawakami A, Nakashima T, Sakai H, Urayama S, Yamasaki S, Hida A: Inhibition of caspase cascade by HTLV -I ... treatment B) and C) Cell viability was quantified using a modified MTT colorimetric assay Quantification of viability in HTLV -I transformed cell lines, as indicated, was af...
Ngày tải lên: 13/08/2014, 13:20
Nitrogen Dynamics and Biomass Production in a Vertical Flow Constructed Wetland Cultivated with Forage Rice and their Mathematical Modeling
... the leaf area Roughly, the plant height increased until 120 days after transplantation, and thereafter a constant height was maintained in every case The leaf area index (LAI), however, increased ... with forage rice is a fascinating subject To design an adequate VF constructed wetland using forage rice, it is required to understand in detail the dynamics of nutrients...
Ngày tải lên: 05/09/2013, 09:38
Tài liệu Báo cáo " Effecting of medium composition on biomass and ginsenoside production in cell suspension culture of Panax vietnamensis Ha et Grushv " doc
... the initial nitrogen concentration of 40 mM [12] In the simultaneous production of ginseng saponin and polysaccharide by suspension cultures of P ginseng, [4] reported that production of ginseng ... different strength of MS medium on biomass and ginsenoside production Table Effect of different strength of MS medium on biomass and ginsenoside prod...
Ngày tải lên: 12/02/2014, 10:20
Báo cáo khoa học: Activator-binding domains of the SWI ⁄ SNF chromatin remodeling complex characterized in vitro are required for its recruitment to promoters in vivo pot
... activation of these genes within the same time window The activator-binding domains in the Swi1 and Snf5 subunits of the SWI ⁄ SNF complex are essential for recruitment of the SWI ⁄ SNF complex to these ... regions of SWI ⁄ SNF cannot replace the recruiting function of the Swi1 and Snf5 activator-binding domains The...
Ngày tải lên: 07/03/2014, 00:20