Is deficit financed growth limited
Is deficit financed growth limited
... this recourse, for deficits are always linked to debts This is the theme we explore in this Strategic Analysis As we expected, real GDP growth responded dramatically to the rise in government deficits: ... 308,000 in March This recovery of employment is in line with our analysis of the effects of the greatly expanded budget deficits, which we discuss below But it is important to place...
Ngày tải lên: 23/09/2015, 08:52
Báo cáo khoa học: ATPase activity of RecD is essential for growth of the Antarctic Pseudomonas syringae Lz4W at low temperature potx
... Nonetheless, the present study identifies the significance of the RecDassociated ATPase activity required during the growth of P syringae at low temperature (4 °C) The very low (but non-zero) ATPase ... knowledge regarding low- temperature- adapted biology We previously discovered that recD is essential for growth of the Antarctic bacterium Pse...
Ngày tải lên: 30/03/2014, 04:20
Tài liệu Báo cáo khoa học: TMPRSS13, a type II transmembrane serine protease, is inhibited by hepatocyte growth factor activator inhibitor type 1 and activates pro-hepatocyte growth factor pdf
... template control A5 49 Protease TMPRSS13 is inhibited by HAI -1 TMPRSS13 HAI -1 HAI-1B HAI -1 GAPDH Fig RT-PCR analysis of TMPRSS13 and HAI -1 mRNA in human carcinoma cell lines Total RNA was isolated ... Tsubouchi H, Naka D, Takahashi K, Okigaki M, Arakaki N, Nakayama H, Hirono S, Sakiyama O, Takahashi K et al (19 89) Molecular cloning and sequence analysis of cDNA for human...
Ngày tải lên: 15/02/2014, 01:20
Tài liệu Báo cáo khoa học: Mitogen-activated protein kinase phosphatase-1 modulated JNK activation is critical for apoptosis induced by inhibitor of epidermal growth factor receptor-tyrosine kinase pdf
... system may be one of the mechanisms responsible for drug -induced apoptosis in a variety of JNK activation is critical for AG1478 -induced apoptosis cancer cells of different histotype [51] Chang ... RA & Davis RJ (2000) Requirement of JNK for stress -induced activation of the cytochrome c-mediated death pathway Science 288, 870–874 JNK activation is...
Ngày tải lên: 18/02/2014, 13:20
Tài liệu Báo cáo khoa học: Human enhancer of rudimentary is a molecular partner of PDIP46/SKAR, a protein interacting with DNA polymerase d and S6K1 and regulating cell growth docx
... GCGGGATCCCTCAGCCCATTGGAAGGCACC ATAAGAATGCGGCCGCTCAGCTGTCACTCAGCCGCAGCAG GCGGGATCCAACAAGGAAGAACCCCCC ATAAGAATGCGGCCGCTCAGTCTGAGGTGATAACATTCCC GCGGGATCCCTGGACGGGCAGCCGATGAAG ATAAGAATGCGGCCGCTCAAAGCTTGATTTTGAATTCTGT ... GCGGGATCCAACAAGGAAGAACCCCCC ATAAGAATGCGGCCGCTCAAGGCAGCTCGCTCTCCTTTTT GCGGGATCCCTCAGCCCATTGGAAGGCACC ATAAGAATGCGGCCGCTCAAGGCAGCTCGCTCTCCTTTTT GCGGGATCCGTGAATAATCTGCACCCTCGA ATAAGA...
Ngày tải lên: 19/02/2014, 05:20
Báo cáo khoa học: Insect cytokine, growth-blocking peptide, is a primary regulator of melanin-synthesis enzymes in armyworm larval cuticle pptx
... (L5D2), day last instar (L6D0), and day last instar (L6D1) larvae (Inset) DDC activity in integuments from the same larval stages a* , Significantly different from TH activity of L5D2 larval dorsal integument ... counter (Aloka LSC5100, Tokyo, Japan) Cloning and sequence analysis of TH cDNA Total RNA was isolated from integuments of day last instar larvae using TRIzol reagent (Gib...
Ngày tải lên: 16/03/2014, 11:20
Báo cáo khoa học: Hepatocyte growth factor activator is a serum activator of single-chain precursor macrophage-stimulating protein potx
... Kataoka H, Miyata S, Uchinokura S & Itoh H (2003) Roles of hepatocyte growth factor (HGF) activator and HGF activator inhibitor in the pericellular activation of HGF/scatter factor Cancer Metastasis ... for activation of hepatocyte growth factor Structural similarity of the protease precursor to blood coagulation factor XII J Biol Chem 268, 10024–10028 Hayashi T,...
Ngày tải lên: 29/03/2014, 23:20
Báo cáo khoa học: Mutation of epidermal growth factor receptor is associated with MIG6 expression docx
... regulatory mechanism of MIG6 in relation to the EGFR mutation The present study is the first to show the association of MIG6 expression with the EGFR mutation in cancer MIG6 ⁄ RALT is known to be ... EGFR mutation and MIG6 expression T Nagashima et al Introduction Epidermal growth factor receptor (EGFR) is a membrane tyrosine kinase that is involved in t...
Ngày tải lên: 30/03/2014, 01:20
báo cáo hóa học:" Enhanced serum concentrations of transforming growth factor-beta1 in simple fatty liver: is it really benign?" pot
... in clinical settings [1] The definition of "benignity" concerning FL is wideaccepted [2] but conceptually difficult to maintain because the mechanisms, i.e., insulin resistance (IR), underlying ... look into the supposed "benignity" of FL and "progressivity" of NASH is to speculate about eventual differences/similarities in mechanisms between the two entities With this in mind...
Ngày tải lên: 18/06/2014, 15:20
Báo cáo sinh học: " Liver mitochondrial dysfunction is reverted by insulin-like growth factor II (IGF-II) in aging rats" doc
... article as: Garcia-Fernandez et al.: Liver mitochondrial dysfunction is reverted by insulin-like growth factor II (IGF -II) in aging rats Journal of Translational Medicine 2011 9:123 Submit your next ... factor I in mammalian brain aging Growth Horm IGF Res 2004, 14(Suppl A):S39-43 30 Tong M, Dong M, de la Monte SM: Brain insulin-like growth factor and ne...
Ngày tải lên: 18/06/2014, 22:20
Báo cáo hóa học: " Markedly impaired bilateral coordination of gait in post-stroke patients: Is this deficit distinct from asymmetry? A cohort study" ppt
... value of indicates “perfect” bilateral coordination, while values further away from reflect increasingly impaired bilateral coordination Impairments in gait asymmetry and bilateral coordination of ... Meijer et al.: Markedly impaired bilateral coordination of gait in post-stroke patients: Is this deficit distinct from asymmetry? A cohort...
Ngày tải lên: 19/06/2014, 08:20
báo cáo hóa học:" Liver mitochondrial dysfunction is reverted by insulin-like growth factor II (IGF-II) in aging rats" pot
... article as: Garcia-Fernandez et al.: Liver mitochondrial dysfunction is reverted by insulin-like growth factor II (IGF -II) in aging rats Journal of Translational Medicine 2011 9:123 Submit your next ... factor I in mammalian brain aging Growth Horm IGF Res 2004, 14(Suppl A):S39-43 30 Tong M, Dong M, de la Monte SM: Brain insulin-like growth factor and ne...
Ngày tải lên: 20/06/2014, 04:20
báo cáo hóa học:" Viral load testing in a resource-limited setting: quality control is critical" potx
... and Jan Gerstoft for assistance with external quality control testing We thank Carol Swantee for advice on viral load quality control We thank Sarah Venis and Stephanie Bartlett for editing assistance ... by an MSF laboratory scientist for: training of personnel; appropriate laboratory facilities; workflow; separation of areas for sample preparation, reagent preparation and samp...
Ngày tải lên: 20/06/2014, 08:20