DESIGN AND CONSTRUCTION OF BIOSENSING PLATFORMS FOR THE DETECTION OF BIOMARKERS
... (Os-RP), and the other is a novel ruthenium complex-tethered redox polymer (Ru-RP) The biosensing membranes are formed through the co-immobilization of glucose oxidase (GOx) and the mediators on the ... sensitive and highly accurate detection devices in a variety of research and commercial applications This thesis focuses on the development of novel biosensing...
Ngày tải lên: 22/09/2015, 15:18
... out -of- plumb construction and foundation tilt GUIDE FOR CONCRETE-PEDESTAL WATER TOWERS The combination of these effects is random, and the deviations implied by Eq (4-1a) should not be used as construction ... moment at the base to the top of the structure as required by ASCE for inverted pendulum structures For ease of calculation, the top of the...
Ngày tải lên: 24/10/2014, 17:26
... design details B.11- Other factors PREFACE Concrete structures have been used in the North Sea and other offshore areas of the world With the rapid expansion of knowledge of the behavior of concrete ... indicated for consideration by the designer The design of offshore structures requires much creativity of the designer, and it is intended that...
Ngày tải lên: 24/10/2014, 17:40
guide for the design and construction of concrete reinforced with frp bars
... 8—FLEXURE The design of FRP reinforced concrete members for flexure is analogous to the design of steel -reinforced concrete members Experimental data on concrete members reinforced with FRP bars show ... in addition to the steel reinforced cross section: two sections reinforced with GFRP bars and one reinforced with CFRP bars For the sec...
Ngày tải lên: 24/10/2014, 21:59
guide for the design and construction of externally bonded frp systems for strengthening concrete structures
... can be computed by taking the first moment of the areas of the transformed section The transformed area of the FRP may DESIGN AND CONSTRUCTION OF EXTERNALLY BONDED FRP SYSTEMS 440.2R-25 Fig 10.1—Typical ... as to develop the strength of the FRP system The development length is a function of the strength of the substrate and the rigidity...
Ngày tải lên: 24/10/2014, 21:59
BS 5588 4 1978 fire precautions in the design and construction of buildings MVAC
... Copy, © BSI BS 5588- 4: 1978 Figure — Steps in obtaining the equivalent resistance of a combination of series and parallel paths of air leakage 12 © BSI 01-1999 BS 5588- 4: 1978 For combinations of series ... and construction of buildings BS 5588- 1, Residential buildings BS 5588- 1.1, Code of practice for single-family dwelling houses3) BS 5588-...
Ngày tải lên: 28/09/2014, 23:27
BS 5588 4 1978 fire precautions in the design and construction of buildings—MVAC
... Copy, © BSI BS 5588- 4: 1978 Figure — Steps in obtaining the equivalent resistance of a combination of series and parallel paths of air leakage 12 © BSI 01-1999 BS 5588- 4: 1978 For combinations of series ... Copy, © BSI Foreword This new code of practice was prepared under the direction of the Fire Standards Committee In addition to the existing BS...
Ngày tải lên: 28/09/2014, 23:27
BS 5588 5 1991 fire precautions in the design and construction of buildings firefighting
... affect the extent of firefighting shafts and of the firefighting lifts and stairs in them The minimum extent of firefighting lifts and stairs is shown in Figure In tall buildings and buildings ... Use of this code Section Planning and construction Firefighting shafts Firefighting stairs 14 Firefighting lobbies 14 Fire mains and landing valve...
Ngày tải lên: 28/09/2014, 23:28
commentary on standard practice for design and construction of concrete silos and stacking tubes for storing gran
... determined by test and the values shown used with caution See Commentary on Section 4.4.1 COMMENTARY ON DESIGN AND CONSTRUCTION OF CONCRETE SILOS AND STACKING TUBES 313R-9 Fig 4-D—Flow chart for selecting ... for computing these bending moments COMMENTARY ON DESIGN AND CONSTRUCTION OF CONCRETE SILOS AND STACKING TUBES 313R-17 Fig 7-A For...
Ngày tải lên: 24/10/2014, 15:45
guide for design and construction of concrete parking lots
... B.7—Support uniformity Uniformity of support for a concrete pavement is key to its longevity Only the most often-used methods for achieving GUIDE FOR DESIGN AND CONSTRUCTION OF CONCRETE PARKING LOTS 330R-27 ... Joints on Performance and Design of GUIDE FOR DESIGN AND CONSTRUCTION OF CONCRETE PARKING LOTS Plain Concrete Pavement,” Highway Res...
Ngày tải lên: 24/10/2014, 15:47
standard practice for design and construction of concrete silos and stacking tubes for storing granular materials
... silos and stacking tubes for storing granular materials Silos for storing of ensilage have different requirements and are not included However, industrial stave silos for storage of granular materials ... ACI STANDARD Standard Methods of Sampling and Testing Concrete Masonry Units Standard Specification for Portland Cement Standard Specificati...
Ngày tải lên: 24/10/2014, 16:04
API 2510 – 2001 design and construction of LPG installations
... Design and Construction of LPG Installations Downstream Segment API STANDARD 2510 EIGHTH EDITION, MAY 2001 American Petroleum Institute Helping You Get The Job Done Right~M SPECIAL NOTES API ... FITTINGS, AND OPTIONAL EQUIPMEN 21 Minimum Horizontal Distance Between Shell of Pressurized LPG Tank and Line of Adjoining Property That May Be Developed Design and...
Ngày tải lên: 27/03/2014, 14:08
Báo cáo hóa học: " A quantum dots and superparamagnetic nanoparticle-based method for the detection of HPV DNA" ppt
... Capture probe 5-GAGGAGGATGAAATAGATGGTCCAGCTGG ACAAGCAGAACCGGACAGAGCCCATTACAATAT TGTAACCTTTTGTTGCAAGTGTGACTCT ACGCTTCGGT-3 Secondary probe 5-GGAGCGACCCAGAAAGTTACCACAGTTATGC ACAGAGCTGCAAACAACTA-3 ... on the basis of the cutoff value Detection of HPV- 16 with QDs and superparamagnetic nanoparticle-based hybridization The rationale of QDs and superparamagnetic nanopartic...
Ngày tải lên: 21/06/2014, 01:20
commentary on design and construction of reinforced concrete chimneys (aci 307-98)
... Concrete Institute 307-69 Specification for the Design and Construction of Reinforced Concrete Chimneys 307-88 Standard Practice for the Design and Construction of Cast-in-Place Reinforced Concrete ... Concrete Chimneys 318 Building Code Requirements for Structural Concrete 505-54 Standard Specification for the Design and Construction of Reinforced...
Ngày tải lên: 24/10/2014, 15:45