Crafting community online and offline landscapes of the indie craft movement

... by wJ S1 ' The rotation of the ubit The connection between the system and the rest of the world is established through the S tueckelbergian of the ubit and the environment , S2 ' and its interaction ... part, 5t , and thus evolve our initial legal state We call the result the ideal Then we let the initial state e·volve by the random 51 and compare th...

Ngày tải lên: 21/09/2015, 21:24

... freshman Majors of the Department of English Linguistics and Literature at the University of Social Science and Humanities - Ho Chi Minh City 327 A survey on the teaching and learning of vowels problematic ... application of the communicative approach to the teaching of English listening comprehension for the first year students at the University of Foreign T...

Ngày tải lên: 21/09/2015, 21:24

... × cm Procedure: - White test cloth is put on to the grating and stag by steel wire - The sample is run twenty times manually for ten seconds and the rubbing fastness of the sample cloth and degree ... stainless steel wire and run ten times manually then assess the staining on to the rubbing cloth and the rubbing fastness of the sample cloth is accessed...

Ngày tải lên: 21/07/2015, 16:54

... Hainanese community and its identity, from both within the community and from outside of the community In the process of exploring the various views of the Hainanese community, this thesis will also ... History of the Hainanese in Malaya] also charts the southward migration of the Hainanese from Hainan Island to Malaya and Singapore and the...

Ngày tải lên: 05/10/2015, 22:32

... of word meal in English and words relating to it (in contrast with Vietnamese equivalents) - Definition of word meal - Field of word meal in English and in Vietnamese equivalents - Cultural and ... with the notion of meal are called field of word meal In our opinion, field of word meal is all the words relating to it mai...

Ngày tải lên: 15/04/2013, 15:11

... Making an investigation of some semantic and pragmatic features of the adjective Warm in English and its equivalents in Vietnamese - Analyzing meanings of the adjective Warm in particular contexts, ... discover, analyze and contrast Some linguists have studied of adjectives as well as semantic and pragmatic characteristics of the adjective Wa...

Ngày tải lên: 26/11/2013, 13:21

... as well as pragmatic features of the WDBs The finding of the pragmatic features of the WDBs leads both teachers and learners of study may be in one way or another beneficial to the language English ... important and significant characteristics of the WDBs As a result, the topic A Contrastive animals that nature has provided to feed both our body a...

Ngày tải lên: 26/11/2013, 13:30

... S103 G145/D137 Y 112 D2 01/ 193 L75/67 G145/D137 E1 41/ 133 K173 /16 5 R207 /19 9 G77/69 D142 /13 4 G197 /18 9 Fig Superposition of PRTFDC1 with HPRT-ImmGP (Protein Data Bank code: 1BZY) (A) Residues in the ... Welin et al Studies of the human PRTFDC1 B A PRTFDC1 25 HPRT 20 10 00 0.2 800 600 400 0 .1 200 –50 50 10 10 50 10 015 0 200 250 S 200 –50 250 50 12 00 10 0 15 0 [H...

Ngày tải lên: 15/02/2014, 01:20

... except in the direction of other spheres These theories throw new light upon the character and extent of the atmosphere of the moon and planets, and the consequent availability of those and other ... position at the present day The present theories of the transmission of light and sound; of the production of winds, and sun-spots, and of...

Ngày tải lên: 17/02/2014, 01:20

... but further than this I am not prepared to go The dip of the rocks exposed in the 17all~gsides is often vcry nearly 1v Stratigraphy and Anr~noniteFauna of East Greenland 13 the same as the gradient ... Type: The example figured by NIKITINis accepted as the holotype of the species The genns and species is represeritcd in East Greenland by two Iv Slratigr...

Ngày tải lên: 17/02/2014, 20:20

... ***** A DISSERTATION ON THE MEDICAL PROPERTIES AND INJURIOUS EFFECT OF THE HABITUAL USE OF TOBACCO: READ, ACCORDING TO APPOINTMENT, BEFORE THE MEDICAL SOCIETY OF THE COUNTY OF ONEIDA, AT THEIR ... consumers, and why the candid among them acknowledge that these evils arise from its use? The health of the medical gentleman above named was materi...

Ngày tải lên: 17/02/2014, 22:20

... that they meet high standards for research quality and objectivity The Dynamic Retention Model for Air Force Officers New Estimates and Policy Simulations of the Aviator Continuation Pay Program ... Department of the Air Force, Aviator Continuation Pay (ACP) Program, Air Force Instruction 36-3004, Washington, D.C., February 24, 2000 T...

Ngày tải lên: 17/02/2014, 23:20

... 0.1 (10% attacks) We analyze both static and dynamic susceptibility of the Internet to faults and attacks In static analysis, we first reconfirm previous work of Albert et al [5] Based on these results, ... of the Internet’s susceptibility to attacks and faults, and discovered two interesting results; First, the Internet is much more preferential tha...

Ngày tải lên: 18/02/2014, 01:20

... 5¢-GTTCACCACCAGAAGCT GGTGTTCTTCGCTGAAGACGTGGGTTCTAACAAG GGTGCT-3¢; Abc, 5¢-CACAACGCCACCAACCATCAGA CCGATGATAGCACCCTTGTTAGAACCCAC-3¢; Abstart, 5¢-GCGTAGGGTCGACATATGGACGCTGAATT CCGTCACG-3¢; Abstop, ... 5¢-CCTGCCGAGCTCCTATTA CACAACGCCACCAACCATCAG-3¢ The PCR solution was prepared in the buffer supplied with the enzyme, and contained Aba, Abb and Abc at 40 nm each, and the start and...

Ngày tải lên: 18/02/2014, 13:20

... (0.04) (0 .19 ) (0.09) 19 83 2493 14 86 18 85 10 30 16 30 13 45 10 38 19 60 805 514 (406) (13 74) (780) ( 710 ) ( 613 ) (809) (740) (542) (10 47) (752) (277) 19 64 15 61 1008 15 96 905 12 97 11 42 468 14 03 276 206 ... S1 Bar graph of R1, R2 and {1H} 15 N NOE values along the sequence of the TTF1 HD at 11 .7 T and 286 K 448 Fig S2 Plot of J(0.87xN)–J(0) correlati...

Ngày tải lên: 18/02/2014, 16:20