Role of oestrogens in male erectile function 1

... dysfunction should be routinely considered in the evaluation of male infertility (Berg, 19 98) The role of oestrogen in male sexual behaviour is still unknown Since the initial clinical report of ... phytoestrogen intake In addition to the scientific understanding of the mechanism of the role of oestrogens in male erectile function, the models established m...

Ngày tải lên: 17/09/2015, 17:21

... Table 14: Causes of Erectile Dysfunction in 30 Patients Indicates precipitating factors delineated for erectile dysfunction (ED) in a group of 30 patients from their presenting history (in addition ... component of the blood vessels The most convincing evidence for the role of prostaglandins in erectile function is the fact that intracavernosal injection of PGE1 is...

Ngày tải lên: 17/09/2015, 17:20

... were incubated with 3. 5µM of atropine and 5.1µM of guanethidine for 30 minutes in order to block the contractile cholinergic and adrenergic responses and to unmask the relaxant response 6.2 .3. 4 Incubation ... leading to further declines in androgen Taking into consideration the prospects of physiological and pharmacological actions of oestrogens in males and the report o...

Ngày tải lên: 17/09/2015, 17:21

... that the oestrogenic influence on the male brain is somewhat more than its role in the female brain at that stage of development since in the female foetus, circulating E2 levels are significantly ... 5.3 .2 Short-Term Treatment Groups The baseline intracavernosal pressure recorded in the control group of rats was 22 .2 2. 1 mm Hg, which was midway between the baseline pressur...

Ngày tải lên: 17/09/2015, 17:21

... WISP1 mRNA and WISP1v proteins As a result, positive signals representing fulllength CCN4 ⁄ WISP1 mRNA and WISP1v were Finally, the biological function of WISP1v and WISP1vx was evaluated using ... stage-dependent expression of WISP1v in vitro Effect of overexpression of CCN4/WISP1 and its variants on the phenotypes of human chondrocytic HCS-2 ⁄ cells Fig Immunohis...

Ngày tải lên: 07/03/2014, 10:20

... 1) An in vitro assay for the actin bundling activity of Annexin A2 clearly indicated enhancement of Annexin A2 activity in the presence of EspL2 protein [8] Furthermore, depletion of Annexin A2 ... filopodia Modification of activity of Annexin A2 by EspL2 Annexins are a family of proteins that bind to membrane phospholipids in a Ca2+-dependent manner...

Ngày tải lên: 29/03/2014, 09:20

... problem among women of reproductive age The behavior and other characteristics of the male partners in this study were important predictors for HIV in women Therefore, involvement of men in HIV ... encouraged to inform their partners and bring them for counseling and testing, and those with proven sexually transmitted infections were given a contact card...

Ngày tải lên: 10/08/2014, 05:20

... ACGTTGGATGAGTCGGTAGCAACACCAGG rev ACGTTGGATGACCATGACACCTTCCTGCTG fwd ACGTTGGATGGGAGTGAAAAGATGTGCTGG rev ACGTTGGATGCCACTTCCTCTGCACAAATC fwd ACGTTGGATGAGAGAACTGGGTTAAGGCAG rev ACGTTGGATGCCAGCACATCTTTTCACTCC ... ACGTTGGATGAAAATACTGGGACTCGAGGC rev ACGTTGGATGTGCTGTATCTATAGCCCTCC fwd ACGTTGGATGGGGCACCAATTAACTAAGGC rev ACGTTGGATGTGAGGGCATGGAAGGTTCAG fwd ACGTTGGATGAGTCGGTAGCAACACCAGGC rev ACGTTGGATGA...

Ngày tải lên: 12/08/2014, 16:20

... Pittet J-F: Early release of high mobility group box nuclear protein after severe trauma in humans: role of injury severity and tissue hypoperfusion Crit Care 2009, 13 :R174 Peltz ED, Moore EE, ... Maruyama K, Abe Y, Uemoto S, Yamada S, Maruyama I: Plasma concentrations and importance of High Mobility Group Box protein in the prognosis of organ failure...

Ngày tải lên: 13/08/2014, 19:20

... illustrates the main structural, theoretical and incentive-related policy implications of circuit theory of finance Section I.2 discusses the special role of the financial system as the core of the circuit ... profitability is declining The internalization of information within the same institution may thus enhance intra -circuit and inter -circuit st...

Ngày tải lên: 24/10/2012, 09:33

... program in Botswana maintains the hegemony and the gap between the poor and the rich, the major and minority groups In order to redress poverty the adult education program needs to be aware of the social ... vital in fighting poverty The adult education program can thus harness the local languages and indigenous knowledge of the minority and...

Ngày tải lên: 05/11/2012, 16:27

... categories of business-to-business advertising are industrial and professional advertising b.1 Industrial advertising Advertising targeted at individuals who buy or influence the purchase of industrial ... Index Introduction Part I : General knowledge of advertising Some typical concepts of advertising Classifications of advertising Part II : The role of adverti...

Ngày tải lên: 16/04/2013, 11:05

... are involved in the effective use of ICTs in the health sector Section explores potential and actual use of ICTs in the health sector It examines the ways in which ICTs can help to strengthen ... critical in ensuring the effective use of ICTs in the health sector Programme designs should consider the role of the intermediary at the s...

Ngày tải lên: 14/02/2014, 09:20