Role of oestrogens in male erectile function 3
... were incubated with 3. 5µM of atropine and 5.1µM of guanethidine for 30 minutes in order to block the contractile cholinergic and adrenergic responses and to unmask the relaxant response 6.2 .3. 4 Incubation ... leading to further declines in androgen Taking into consideration the prospects of physiological and pharmacological actions of oestrogens in males and the report o...
Ngày tải lên: 17/09/2015, 17:21
... Table 14: Causes of Erectile Dysfunction in 30 Patients Indicates precipitating factors delineated for erectile dysfunction (ED) in a group of 30 patients from their presenting history (in addition ... component of the blood vessels The most convincing evidence for the role of prostaglandins in erectile function is the fact that intracavernosal injection of PGE1 is...
Ngày tải lên: 17/09/2015, 17:20
... that the oestrogenic influence on the male brain is somewhat more than its role in the female brain at that stage of development since in the female foetus, circulating E2 levels are significantly ... 5.3 .2 Short-Term Treatment Groups The baseline intracavernosal pressure recorded in the control group of rats was 22 .2 2. 1 mm Hg, which was midway between the baseline pressur...
Ngày tải lên: 17/09/2015, 17:21
Role of oestrogens in male erectile function 1
... dysfunction should be routinely considered in the evaluation of male infertility (Berg, 19 98) The role of oestrogen in male sexual behaviour is still unknown Since the initial clinical report of ... phytoestrogen intake In addition to the scientific understanding of the mechanism of the role of oestrogens in male erectile function, the models established m...
Ngày tải lên: 17/09/2015, 17:21
THE ROLE OF SURGERY IN HEART FAILURE - part 3 pptx
... better understanding of the anatomy and pathophysiology of heart failure The failing heart beats at more than 120,000 beats per day, pumping more than 6,000 L of blood against an increased systemic ... This procedure was the landmark beginning of cardiac pacing (Fig 1) For the past 50 years cardiac surgery has been in a continuous state of flux In congenital hear...
Ngày tải lên: 11/08/2014, 15:20
Investigation of the role of microRNAs in spinocerebellar ataxia type 3
... 19 -33 Ataxia type (SCA1) Spinocerebellar Ataxia type (SCA2) Spinocerebellar Ataxia type (SCA3) Spinocerebellar Ataxia type (SCA6) calcium channel subunit Spinocerebellar ATXN7 Ataxin 4 -35 37 -30 6 ... interspersed by introns that are omitted in the ATXN3 mRNA (b) The initial exons code for the Josephin domain in the ATXN3 protein, the rest of the e...
Ngày tải lên: 26/11/2015, 10:00
Báo cáo khoa học: Cytoskeleton-modulating effectors of enteropathogenic and enterohemorrhagicEscherichia coli: role of EspL2 in adherence and an alternative pathway for modulating cytoskeleton through Annexin A2 function pot
... 1) An in vitro assay for the actin bundling activity of Annexin A2 clearly indicated enhancement of Annexin A2 activity in the presence of EspL2 protein [8] Furthermore, depletion of Annexin A2 ... filopodia Modification of activity of Annexin A2 by EspL2 Annexins are a family of proteins that bind to membrane phospholipids in a Ca2+-dependent manner...
Ngày tải lên: 29/03/2014, 09:20
Báo cáo y học: "IV among pregnant women in Moshi Tanzania: the role of sexual behavior, male partner characteristics and sexually transmitted infections" pot
... problem among women of reproductive age The behavior and other characteristics of the male partners in this study were important predictors for HIV in women Therefore, involvement of men in HIV ... encouraged to inform their partners and bring them for counseling and testing, and those with proven sexually transmitted infections were given a contact card...
Ngày tải lên: 10/08/2014, 05:20
Báo cáo y học: " The role of polymorphisms in ADAM33, a disintegrin and metalloprotease 33, in childhood asthma and lung function in two German populations" doc
... ACGTTGGATGAGTCGGTAGCAACACCAGG rev ACGTTGGATGACCATGACACCTTCCTGCTG fwd ACGTTGGATGGGAGTGAAAAGATGTGCTGG rev ACGTTGGATGCCACTTCCTCTGCACAAATC fwd ACGTTGGATGAGAGAACTGGGTTAAGGCAG rev ACGTTGGATGCCAGCACATCTTTTCACTCC ... ACGTTGGATGAAAATACTGGGACTCGAGGC rev ACGTTGGATGTGCTGTATCTATAGCCCTCC fwd ACGTTGGATGGGGCACCAATTAACTAAGGC rev ACGTTGGATGTGAGGGCATGGAAGGTTCAG fwd ACGTTGGATGAGTCGGTAGCAACACCAGGC rev ACGTTGGATGA...
Ngày tải lên: 12/08/2014, 16:20
Evaluation of the role of autophagy in fungal development and pathogenesis 3
... 297 298 30 0 30 2 30 3 30 4 30 6 30 7 30 7 30 8 Abstract Autophagy is a bulk degradative process responsible for the turnover of membranes, organelles, and proteins in eukaryotic cells Genetic and molecular ... regulated in the atg8Δ mutant and investigate the role of autophagy and nutrient utilization during conidiation and in planta growth in Magnap...
Ngày tải lên: 11/09/2015, 10:01
Development of sphingosine kinase (SPHK) inhibitors and the role of sphingolipids in adult stem cell proliferation and differentiation 3
... 3. 1 .3 Staining 3. 1 .3. 1 Alizarin Red S Staining Alizarin Red S staining is widely used to evaluate the calcium-rich deposits generated by cells In this study, the staining was used to detect the ... difference compared with the induced cells without inhibitors Interestingly and similarly with the hFOB test, 1μM of DMS and 5μM of CP6 inhibited the differentiatio...
Ngày tải lên: 11/09/2015, 16:06
Circuit theory of finance and the role of incentives in financial sector reform
... illustrates the main structural, theoretical and incentive-related policy implications of circuit theory of finance Section I.2 discusses the special role of the financial system as the core of the circuit ... profitability is declining The internalization of information within the same institution may thus enhance intra -circuit and inter -circuit st...
Ngày tải lên: 24/10/2012, 09:33
The role of language in adult education and poverty reduction in Botswan
... program in Botswana maintains the hegemony and the gap between the poor and the rich, the major and minority groups In order to redress poverty the adult education program needs to be aware of the social ... vital in fighting poverty The adult education program can thus harness the local languages and indigenous knowledge of the minority and...
Ngày tải lên: 05/11/2012, 16:27
The role of advertising in society
... categories of business-to-business advertising are industrial and professional advertising b.1 Industrial advertising Advertising targeted at individuals who buy or influence the purchase of industrial ... Index Introduction Part I : General knowledge of advertising Some typical concepts of advertising Classifications of advertising Part II : The role of adverti...
Ngày tải lên: 16/04/2013, 11:05