Expression of recombinant proteins in tobacco system

... affecting molecular farming of recombinant proteins The expression of foreign proteins was studied in a tobacco system with four major objectives In the first part, a plant-E coli shuttle vector system ... for recombinant proteins Targeting signals retain recombinant proteins within distinct compartments of 28 the cells, preserve integrity and protect them from...

Ngày tải lên: 12/09/2015, 11:08

... derivative of pASV82 (8.2 kb) containing the GUS expression cassette, was constructed by inserting the 3-kb HindIII fragment of pRTL2-GUS (Carrington et al 1991) into the HindIII site of pASV82 ... region The recombinant plasmids described in the Results are indicated in boxes The unique HindIII in pASV82 can be used to clone expression cassettes with the gene of interest...

Ngày tải lên: 16/09/2015, 17:13

... level of Mcm expression in HeLa cells and cancer cells from human uterine cervix Although it remains to be determined how enhanced expression of Mcm proteins affects DNA replication in cancer cells, ... significance of Mcm proteins in the aberrant proliferation of cancer cells In addition, Mcm3 and proteins seem to be useful as a marker to...

Ngày tải lên: 20/02/2014, 23:20

... study is to investigate the IL-13 and IFN-g effect on the expression of the surfactant proteins using primary human adult ATII cells in monolayer culture in vitro The experiments with human ATII ... effect of IL-13 or IFN-g on the expression of surfactant proteins in primary adult human ATII cells has not been reported Methods for isol...

Ngày tải lên: 12/08/2014, 11:23

... DISCUSSION The findings in this study show that GR is highly expressed in epithelial cells of the male genital tract, especially in the Ó FEBS 2002 Glutathione reductase in male reproduction system ... level of expression of aldose reductase was also detected in the epithelia of the male genital tract In addition, glutathione S-transferase is pre...

Ngày tải lên: 17/03/2014, 17:20

... myristoylation motif Met-Gly-Ala-Ala-Ala-Ala-Ala-AlaAla-Ala or Met-Gly-Ala-Ala-Ala-Ser-Ala-Ala-Ala-Ala was amplified by PCR with the primers AGG1 RV and 3A6 (A ⁄ S) FW (Table S3) and with pTA2–AGG1 as the ... to the myristoylation motifs Met-Gly-Xaa-Ala-AlaAla-Ala-Ala-Ala-Ala (Myr–AGG1-3X 6A) or Met-Gly-Xaa-Ala-Ala-Ser-Ala-Ala-Ala-Ala (Myr–AGG1-3X6S) (B, C) Each of the 20 mRNAs co...

Ngày tải lên: 29/03/2014, 21:20

... Bishop DH: Sequences and coding strategies of the S RNAs of Toscana and Rift Valley fever viruses compared to those of Punta Toro, Sicilian Sandfly fever, and Uukuniemi viruses Virology 1991, ... MS: Messenger RNA of the M segment RNA of Rift Valley fever virus Virology 1986, 151(1):151-156 Le May N, Gauliard N, Billecocq A, Bouloy M: The N terminus of Rift...

Ngày tải lên: 20/06/2014, 01:20

... to explain the large variability observed in the levels of recombinant protein yield Recent studies on the transcriptomic profiling of recombinant cultures has improved our understanding on the ... in molecular biology 267:155–167 doi:10.1186/2191-0855-1-33 Cite this article as: Sharma et al.: Comparative transcriptomic profile analysis of fed-batch cultures exp...

Ngày tải lên: 20/06/2014, 23:20

... ARTICLE Open Access Structure and expression of the maize (Zea mays L.) SUN- domain protein gene family: evidence for the existence of two divergent classes of SUN proteins in plants Shaun P Murphy1, ... previously unknown class of SUN- related proteins in plants mRNA Expression Profiling of ZmSUN Protein Genes The conservation...

Ngày tải lên: 11/08/2014, 11:21

... persistently HBV expressing cell line HepG2.215 and its parent cell line, a non-HBV expressing cell line HepG2 We found that cIAP1 and cIAP2 were clearly increased in the HBV expressing cells but XIAP ... expression in the HBV expressing cells was first investigated by the comparison of the gene expression profile in the HepG2.215 and HepG2 cells using gene arra...

Ngày tải lên: 02/11/2012, 11:17

... important for further investigation Number of ammonia oxidizers and copy number of amoA mRNA The time courses of the copy number of amoA mRNA and the number of ammonia oxidizer are shown in Fig No significant ... PCR-reaction-1) Community analysis of ammonia oxidizer based on amoA mRNA The difference of the effect of polyferric sulfate...

Ngày tải lên: 05/09/2013, 10:15

... devoid of a given essential amino acid Our data suggest that the GCN2 pathway is directly involved in the regulation of amino acid and protein metabolism, as many of the genes involved in these processes ... their biological processes reveals that amino acid limitation regulates groups of genes that are involved in amino acid and pro...

Ngày tải lên: 07/03/2014, 03:20

... used for RT-PCR were: for the I7 OR (5¢-CGTCAAGGAGAAAAAACCCCGGATCT AAAAAATGGAGCGAAGGAACCACAG-3¢) and (5¢-AG CTGCCTGCAGGTCGACTCTAGAGGATCCTAACCAA TTTTGCTGCC-3¢); for OR17-40 (5¢-CGTCAAGGAG AAAAAACCCCGGATCTAAAAAATGGAGCAGAAAC ... recombination introducing the c-myc-OR17-40 coding sequence, using primers (5¢-CGTCAAGGAGAAAAAAC CCCGGATCTAAAAAATGGAGCAGAAACTCATCTC TGAAGAGGATCTG-3¢) and (5¢-G...

Ngày tải lên: 07/03/2014, 16:20

... hupUV genes are apparently intact, yet the hydrogen sensing system is not functional in T roseopersicina BBS Results Hydrogen independent hupSL expression The HupSL enzyme of T roseopersicina is ... E-value of 1.2e-140) The presence of the hupR gene in T roseopersicina is in apparent contradiction with the absence of a hydrogen- dependent regulation of...

Ngày tải lên: 16/03/2014, 23:20