Part development of novel methods for the synthesis of homoallylic alcohols part II multigrams synthesis of ( ) epibatidine

... 25 25 25 Time (h) 2.0 5.0 6.0 1.5 5.0 2.0 Yield %b (1 03:10 4) (E/Z)c 25 (1 00: 0) (8 0/2 0) 23 (1 00: 0) (8 0/2 0) 25 (7 6:2 4) (8 0/2 0) 45 (1 00: 0) (8 0/2 0) 49 (1 00: 0) (8 0/2 0) 69 (1 00: 0) (8 0/2 0) 105 105a 105b ... Yield 9a (% ) ( : ) (E/Z) 15 (7 5:2 5) (1 00/ 0) 22 (2 3:7 7)...

Ngày tải lên: 16/09/2015, 17:11

... al for amorphous titania nanotubes [30] However, the annealed titania nanotubes are crystalline (mostly anatase) and show varied activity depending on the material preparation and annealing atmosphere ... (3.3 mA/cm2 ; Fig 13) This is due to the lower band gap of carbon-doped titania nanotubes compared with N2 - and O2 annealed nanotubes The lower the band gap of...

Ngày tải lên: 05/05/2014, 15:26

... capping CuO, AP-Fe2O3, AP-Al2O3 and AP -CaO [15­ agent was reported Then, we have focused 20] There are several methods for the synthesis our attention on the CaO nanoparticles/ of nanoscale CaO, including ... (2013) GC analysis illustrated that 75% and 100% of 2-CEPS For the evaluation of the reaction of 2-CEPS in contact to the CaO NPs with weight ratio as a...

Ngày tải lên: 06/05/2014, 08:55

... synthesis of novel materials and the development of new processes Solvothermal synthesis of novel materials Roy has described the challenge for synthesizing new materials to specification [32] Hydro- and ... Conclusion Solvothermal reactions appear to be important for either the synthesis of novel materials, the preparation of nanostructured particl...

Ngày tải lên: 20/03/2014, 13:08

... evaluation of the performance of a classification algorithm The SN is the proportion of correct positive classifications out of the number of true positives The SP is the proportion of correct ... classifications out of the number of true negatives The accuracy is the total number of correct classifications out of the total number of samples The PPV...

Ngày tải lên: 14/08/2014, 17:22

... topologies of manufacturing systems 2.2 Analytical methods for the performance evaluation of manufacturing systems There has been a plethora of literature on the analytical modeling of production systems ... objective of this thesis is to develop analytical methods to evaluate the performance of multiple part- type production systems The...

Ngày tải lên: 09/09/2015, 18:59

... DEVELOPMENT OF NMR METHODS FOR THE STRUCTURAL ELUCIDATION OF LARGE PROTEINS ZHENG YU (B.Sc., Xiamen University) A THESIS SUBMITTED FOR THE DEGREE OF DOCTOR OF PHILOSOPHY DEPARTMENT OF BIOLOGICAL ... analysis of complex, x    Development of NMR methods for the structural elucidation of large proteins Summary   crowded and folded high-dime...

Ngày tải lên: 11/09/2015, 09:57

... DEVELOPMENT OF NEW METHODOLOGIES FOR THE SYNTHESIS OF ENANTIOMERICALLY ENRICHED COMPOUNDS LEE CHENG HSIA ANGELINE (B.ApplSc (Hons.), NUS) A THESIS SUBMITTED FOR THE DEGREE OF DOCTOR OF PHILOSOPHY ... alcohols, there are no reported illustrations for the synthesis of the cis-linear regioisomer Herein, an effective and unusual approach towards the synt...

Ngày tải lên: 16/09/2015, 08:30

... determination is the spectral assignment procedure This involves sequence-specific resonance assignment of NMR signals and the assignment of NOESY spectra Resonance assignment forms the basis for characterizing ... obtain the assignments of the Cα and CO of the same residue Then, the CO frequency is used to obtain assignments for the HN and 15N of...

Ngày tải lên: 04/10/2015, 15:52

... an effort to develop an effective extraction method for bioflocculants from the microbial cell surface Materials and Methods Activated sludge samples Activated sludge samples were collected from ... was the most effective extraction method for activated sludge However, cell disruption is not effective for the isolation of bioflocculants Thus, NaOH extr...

Ngày tải lên: 05/09/2013, 09:08

... qualitative evaluation of lexical association measures, mainly for the following reasons: the instability of precision values obtained from the rst few percent of the data in the SLs; the lack of signicant ... precision values above 50% for the rst 10% of the list, but is outperformed by the t-test afterwards Looking at the rst 40% of the data, th...

Ngày tải lên: 20/02/2014, 18:20

... (Paris, France): 5forGulox (forward), 5¢-GGGGACAAGTTT GTACAAAAAAGCAGGCTTCGATGACGACGACAAG ATGAGCCCGATATGGAGTAATTGGCCT-3¢; and 3revGulox (reverse), 5¢-GGGGACCACTTTGTACAAGAAA GCTGGGTCTCAGGGACCGAGAACGCGCCGGGTGT ... as a direct electron acceptor The animal and plant l-gulonolactone oxidoreductases are also active towards the l-galactono-1,4-lactone substrate Only scarce data are available on...

Ngày tải lên: 07/03/2014, 12:20

... Nakano, Y. , Yoshida, Y. , Nakao, H., Yamashita, Y & Koga, T (2000) Genetic analysis of the gene cluster for the synthesis of serotype a-specific polysaccharide antigen in Actinobacillus actinomycetemcomitans ... encoding the biosynthesis of GDP-6-deoxy-D-talose nor its corresponding protein has been found Recently, we cloned and characterized a gene cluster involve...

Ngày tải lên: 17/03/2014, 10:20

... patterns of the ZnO sample synthesized at 120 ◦C for 17 h hydrothermal treatment Figure a b d e c f Fig SEM images of the time-dependent evolution in the formation of 3D flower-like ZnO synthesized ... of the formation process of the 3D flower-like ZnO Figure Fig (a) Bar graph illustration of the photocatalytic degradation of KGL using ZnO samples s...

Ngày tải lên: 06/05/2014, 13:26

... number of spins By linearity of the Fourier transform the direct relation between the peak integral and the number of spins of the corresponding chemical group holds for the spectrum of superposed ... derivation due to the time-dependence of the unit vectors Using the product rule for the derivation and the fact that the time derivative of the u...

Ngày tải lên: 29/05/2014, 18:32