Structural investigations of redox regulation in ATFKBP13 3

... Reflections (working/test) 40 ,30 9/4, 530 40,687/4,569 0.21 / 0. 23 0.20 / 0. 23 Non-hydrogen atoms 4, 630 4, 630 Waters 4 63 3 13 Protein 21.497 32 .36 7 Waters 32 .060 39 .37 9 R.M.S.D in bond lengths (Å) ... 3. 8.2 Crystallization of AtFKBP 13- (SH)2 Crystals of reduced AtFKBP 13 [AtFKBP 13- (SH)2] were produced in the same way as the oxidized AtFKBP 13 crystals T...

Ngày tải lên: 16/09/2015, 15:55

... experiments to determine the interacting domains of the AtFKBP13 and the Rieske proteins A number of cDNA fragments encoding various domains of the AtFKBP13 or Rieske protein were fused in frame with ... process 4. 2 .4 Mature FKBP13 is a target for reduction by thioredoxin The possibility of thioredoxin-linked reduction of AtFKBP13 arose from the finding of two solvent...

Ngày tải lên: 16/09/2015, 15:55

... processes diurnally in an effective manner The ferredoxin/thioredoxin system—composed of ferredoxin, ferredoxin-thioredoxin reductase and thioredoxin— facilitates these redox changes in the target ... SH3 domains It is possible that immunophilin-like domains will be found in other proteins not thought of as immunophilins In this vein, it is interesting to note that the scaffoldi...

Ngày tải lên: 16/09/2015, 15:55

... more flexibility, both of the backbone of the protein and of the spacing between particular residues [Bowie et al., 19 91] Each residue of a protein is assigned one of 18 environment classes, ... crystallography Instead of stereochemical parameters, Sippl (19 93) uses knowledge of the forces, which stabilize proteins in solution in the analysis of the energy distribution...

Ngày tải lên: 16/09/2015, 15:55

... before hypoxia to further confirm the mechanism of BSO modulating the Page of expression of HIF-1a by the changes of micro-environment redox status in the cells Intracellular GSH assay After the ... considered the mechanism, the redox status influencing the expression of HIF1a, as following: (i) The biosynthesis of GSH impose a reducing micro-en...

Ngày tải lên: 10/08/2014, 10:21

... but rather a vital part of the war effort; they turned lipstick into a symbol of resilient femininity in the face of danger, a symbol that would boost the morale of both the women wearing the lipstick ... sides of the ocean.238 Max Factor developed the first truly indelible lipstick, in the sense of long-lasting rather than of permanent, titled Tru...

Ngày tải lên: 16/01/2014, 22:20

... Annals of Mathematics, 160 (2004), 523–572 The space of embedded minimal surfaces of fixed genus in a 3-manifold III; Planar domains By Tobias H Colding and William P Minicozzi II* Introduction ... from the boundary Here small means contained in a small ball 527 PLANAR DOMAINS A “pair of pants” (in bold) Graphical annuli (dotted) separate the “pai...

Ngày tải lên: 14/02/2014, 17:20

... residue in the N-terminal part of the peptide that binds in the with the C-terminal domain in CaM However in PhK5 Trp357 is found at the C-terminal end of the peptide This suggests that either PhK5 ... occurring on binding of the peptide and could indicate that the binding of PhK5 to Ca2+⁄ CaM is similar to that observed for Ca2+⁄ CaM binding to i...

Ngày tải lên: 19/02/2014, 17:20

... AAATGAGCCCAACAAAGCCGAGAAAAACATT AATTTGATGCTCGACAGGCTGCCGCGGAGACATGG CAATCCGGGAGACAGCTGGTGATGAAAA TAGCCACACTTGCAGCCGCGGCCAAAAATG TTAATGGGGATGAGAGCGGTTGCCACTTTCT AGATGGGTTGGCAACTTTCGCTTCAAAA TGAAAACCGCCAGTGCTATTGCTGTGAACA ... TGAAAACCGCCAGTGCTATTGCTGTGAACA CCTGACAGCAACTACGCAGCGTTCTGTTCAG AGCAACTATCCACCGTTCGCTTCAGGGACTG TGCTTCATCTTGCTGACGTGTACGTGGGACT ATGTGTACGTGGGACTGGCACTTCGAAAGC AAAATGGCCTACA...

Ngày tải lên: 08/03/2014, 16:20

... ——— , The space of embedded minimal surfaces of fixed genus in a 3-manifold V; Fixed genus, in preparation [CM8] ——— , Embedded minimal disks, in Minimal surfaces (MSRI , 2001), Clay Mathematics ... π In either case the separation w = π A multi-valued minimal graph is a multi-valued graph of a function u satisfying the minimal surface equ...

Ngày tải lên: 14/03/2014, 22:20

... [104,105] and in S cerevisiae [88] have lead to a profound understanding of how DNA binding, inducer binding and dimerization function in TetR This informa- Gene regulation by tetracyclines (Eur ... concentrations of tc for full induction [15] These conflicting requirements are met by the genetic organization of the resistance determinants (reviewed in [6]) and...

Ngày tải lên: 23/03/2014, 21:20

Ngày tải lên: 24/04/2014, 17:15

... harmonics information contained in the audio signals In the feature extraction, we proceed in two stages as indicated by Figure In the first stage, we use a small analysis window to investigate how the ... sequence of length N = 901, corresponding to 15 minutes of audio Tripling the length N by using a threefold concatenation of the Bolero results in a running...

Ngày tải lên: 22/06/2014, 23:20