Identification and characterization of agrobacterium tumefaciens vird2 binding protein

Identification and characterization of agrobacterium tumefaciens vird2 binding protein

Identification and characterization of agrobacterium tumefaciens vird2 binding protein

... Identification and Characterization of a VirD2- binding Protein 80 3.1 Identification of a Novel VirD2- binding Protein 80 3.2 Expression and Purification of Three VBP Proteins 93 3.2.1 Construction of plasmids ... IDENTIFICATION AND CHARACTERIZATION OF AGROBACTERIUM TUMEFACIENS VirD2- BINDING PROTEINS GUO MINLIANG (M Sc.) A THESIS SUBMITTED FOR THE...

Ngày tải lên: 16/09/2015, 15:55

208 257 0
Identification and characterization of novel group 5 and group 21 allergens from dust mite and ige binding epitope mapping of blo t 5

Identification and characterization of novel group 5 and group 21 allergens from dust mite and ige binding epitope mapping of blo t 5

... thermal treatment on IgE- binding activities of Blo t 92 and Blo t 21 4.2.2 Effect of thermal treatment on Blo t and Blo t 21 folding 94 4.2.3 Resistance of IgE- binding of Blo t and Blo t 21 to acid, ... 21 75 and Blo t 3.2.10 Quantitative end point cross-inhibition of Blo t 21 and 77 Blo t 3.2.11 Localization of Blo...

Ngày tải lên: 14/09/2015, 12:44

259 432 0
Báo cáo khóa học: Overexpression and enzymatic characterization of Neisseria gonorrhoeae penicillin-binding protein 4 ppt

Báo cáo khóa học: Overexpression and enzymatic characterization of Neisseria gonorrhoeae penicillin-binding protein 4 ppt

... range of 4. 27.5 and the male urethra having a pH of 6.28 .4 The pH dependence of NG PBP (pKa values of 6.9 and 10.1) therefore overlaps the alkaline side of the physiological growth range of N gonorrhoeae ... and characterization of the ponA gene encoding penicillin-binding protein from Neisseria gonorrhoeae and Neisseria meningitidis J Bacteriol 179, 27...

Ngày tải lên: 23/03/2014, 12:20

10 328 0
Báo cáo Y học: Identification and characterization of thioredoxin and thioredoxin reductase fromAeropyrum pernixK1 pdf

Báo cáo Y học: Identification and characterization of thioredoxin and thioredoxin reductase fromAeropyrum pernixK1 pdf

... transhydrogenase assay described by Gan et al [25] Cloning of the two genes from A pernix K1 Thioredoxin reductase activity assays Assays for thioredoxin reductase activity were carried out by two ... 2002 Thioredoxin system of Aeropyrum pernix (Eur J Biochem 269) 5425 Thioredoxin activity assays RESULTS Thioredoxin activity was determined by the insulin precipitation assay...

Ngày tải lên: 23/03/2014, 21:20

8 414 0
Báo cáo sinh học: " CODEHOP-mediated PCR – A powerful technique for the identification and characterization of viral genomes" pptx

Báo cáo sinh học: " CODEHOP-mediated PCR – A powerful technique for the identification and characterization of viral genomes" pptx

... TTTGACCTGGAGACTATGttymgngartayaa ACCTTCATCAAAAATCCCttnggnggnatgyt GACGACCGCAGCGTGTGCGTGaaygtnttyggnca TAAAAGTACAGCTCCTGCCCGaanacrttnacrca TTAGCTACTCCGTGGAGCagyttrtcraarta GAAGTGGCAGTTGGAGAGGCTGACCTCCcartcncc ... GTGGTCGATTTTGCCAGCCTGTACCCGAGCATCATCCAGGCGCACAACCTGTGC GTAGTAGACTTTGCTAGCCTGTATCCTAGTATTATACAAGCTCATAATCTATGC GTGGTGGACTTTGCCAGCCTGTACCCCACCATCATCCAGGCCCACAACCTCTGC GTAGTGGACTTTGCCAGC...

Ngày tải lên: 18/06/2014, 22:20

24 605 0
báo cáo hóa học:" Identification and characterization of a spontaneous ovarian carcinoma in Lewis rats" docx

báo cáo hóa học:" Identification and characterization of a spontaneous ovarian carcinoma in Lewis rats" docx

... of proband Intraperitoneal tumor arising spontaneously in a Lewis rat has pathologic appearance of an ovarian adenocarcinoma (A) Proband shows tumor of the left ovary and intraperitoneal tumor ... D, Atkins L, Kato DT, Buczek-Thomas J, Fuller AF Jr, Hasan T: Characterization of a xenograft model of human ovarian carcinoma which produces intraperitoneal carcinomatos...

Ngày tải lên: 20/06/2014, 07:20

8 441 0
Báo cáo hóa học: " Identification and characterization of alkaline serine protease from goat skin surface metagenome" docx

Báo cáo hóa học: " Identification and characterization of alkaline serine protease from goat skin surface metagenome" docx

... al.: Identification and characterization of alkaline serine protease from goat skin surface metagenome AMB Express 2011 1:3 Submit your manuscript to a journal and benefit from: Convenient online ... and Gly-Thr-SerMet-Ala-X-Pro, which is characteristic of serine subfamily S8A Results from the sequence analysis of this protease suggested it to be serine...

Ngày tải lên: 21/06/2014, 05:20

10 426 0
Báo cáo sinh học: "Small-molecule modulators of Hedgehog signaling: identification and characterization of Smoothened agonists and antagonists." pps

Báo cáo sinh học: "Small-molecule modulators of Hedgehog signaling: identification and characterization of Smoothened agonists and antagonists." pps

... approach of identifying and studying the mechanism of action of small-molecule agonists (and antagonists), we hoped to uncover some of the complexities of the Hh-signaling system Small-molecule modulators ... activation with a Hh-protein ligand has therapeutic value [49,50] On the basis of our current understanding of these models and the specific mechanism of action...

Ngày tải lên: 06/08/2014, 18:20

19 322 0
Báo cáo y học: "Identification and characterization of the carboxy-terminal region of Sip-1, a novel autoantigen in Behçet''''s disease" docx

Báo cáo y học: "Identification and characterization of the carboxy-terminal region of Sip-1, a novel autoantigen in Behçet''''s disease" docx

... the protein Sip1 Sip1 is a nuclear splicing factor containing an arginine/serine-rich domain and a RNAbinding motif that may play a role in linking the processes of transcription and pre-mRNA ... participated in the design and revision of the study and performed the statistical analysis RP participated in the design and revision of the study AS partic...

Ngày tải lên: 09/08/2014, 08:22

8 550 0
Báo cáo y học: "The identification and characterization of a novel protein, c19orf10, in the synovium" docx

Báo cáo y học: "The identification and characterization of a novel protein, c19orf10, in the synovium" docx

... staining (g) Intense staining of a hyperplastic RA synovial lining cell layer This staining was typical of most areas of RA synovium where the lining was hyperplastic (h) An area of an RA synovial ... stained positively (arrow) (e) Intense staining of individual cells in the lining layer of a typical OA synovium (f) An area of an OA synovium demonstrates a lining lay...

Ngày tải lên: 09/08/2014, 10:20

9 490 0
báo cáo khoa học: " Identification and characterization of the Nonrace specific Disease Resistance 1 (NDR1) orthologous protein in coffee" doc

báo cáo khoa học: " Identification and characterization of the Nonrace specific Disease Resistance 1 (NDR1) orthologous protein in coffee" doc

... 11 9 11 9 11 8 11 6 11 7 11 9 92 12 6 15 1 14 2 11 8 11 8 11 3 11 2 14 2 14 0 16 6 PFYQGHKN Figure The two coffee candidates for NDR1 protein belong to the NHL family Putative Arabidopsis orthologs of CaNDR1a/b ... Biology 2 011 , 11 :14 4 http://www.biomedcentral.com /14 71- 2229 /11 /14 4 (a) CE (b) 12 0 Page 10 of 17 μ PM PMA2 86 NDR1 47 34 (c) (μg) 10 15 PM...

Ngày tải lên: 11/08/2014, 11:21

17 455 0
báo cáo khoa học: " Identification and characterization of wheat long non-protein coding RNAs responsive to powdery mildew infection and heat stress by using microarray analysis and SBS sequencing" ppsx

báo cáo khoa học: " Identification and characterization of wheat long non-protein coding RNAs responsive to powdery mildew infection and heat stress by using microarray analysis and SBS sequencing" ppsx

... as: Xin et al.: Identification and characterization of wheat long non-protein coding RNAs responsive to powdery mildew infection and heat stress by using microarray analysis and SBS sequencing ... response to biotic and/ or abiotic stresses in wheat Results Identification of powdery mildew infection and heat stress responsive...

Ngày tải lên: 11/08/2014, 11:21

13 417 0
báo cáo khoa học: " Identification and characterization of flowering genes in kiwifruit: sequence conservation and role in kiwifruit flower development" ppt

báo cáo khoa học: " Identification and characterization of flowering genes in kiwifruit: sequence conservation and role in kiwifruit flower development" ppt

... Page of 15 Figure Expression profiles of Actinidia flowering genes in mature plant organs Real-time RT-PCR analysis of the Actinidia flowering genes in the root, stem internode, leaf, flower and ... Figure Expression profiles of Actinidia flowering genes in normal and aberrant flowers Real-time RT-PCR analysis of the Actinidia flowering genes in the lea...

Ngày tải lên: 11/08/2014, 11:22

16 389 0
báo cáo khoa học: " Identification and characterization of plant Haspin kinase as a histone H3 threonine kinase" ppsx

báo cáo khoa học: " Identification and characterization of plant Haspin kinase as a histone H3 threonine kinase" ppsx

... important for ATP binding, has no kinase activity [13] To examine whether purified GST-AtHaspin has kinase activity, an in vitro kinase assay was performed using purified GST-AtHaspin and GST-AtHaspin ... Dlk/ZIP kinase orthologues, and thus, AtHaspin has an additional role as a H3 Thr11 kinase in A thaliana Phosphorylation of histone H3 at Thr3 and Thr11 Mitotic...

Ngày tải lên: 11/08/2014, 11:22

14 333 0
w