Computational media aesthetics for media synthesis

... Summary of The Dissertation 7.1.1 Aesthetics for Single Image 7.1.2 Aesthetics for Multiple Images 7.1.3 Aesthetics for Videos 7.1.4 Aesthetics for Online Advertising 7.2 Conclusions ... definition, applied media aesthetics is different in several aspects 1.2 Methodology of Applied Media Aesthetics • Applied media aesthetics does not try to answer the eternal questi...

Ngày tải lên: 15/09/2015, 22:18

... full expressiveness MM References C Dorai and S Venkatesh, Computational Media Aesthetics: Finding Meaning Beautiful,” IEEE MultiMedia, vol 8, no 4, Oct.–Dec 2001, pp 10-12 26 R Zhao and W.I ... consistency, repeatability, and robustness Final thoughts IEEE MultiMedia What does the CMA philosophy bring to this situation? Does systematic attention to domain distinctives, such as film gr...

Ngày tải lên: 07/03/2014, 17:20

... this thesis is to model the characteristics of Vietnamese prosody for speech synthesis It focuses on the influences of the macro -prosody on the micro -prosody, in three types of sentence: assertive, ... characteristics of Vietnamese prosody to generate the prosody description” for speech synthesis In this thesis, we just focus on the differences of...

Ngày tải lên: 19/02/2014, 08:58

... assistant; to Ian Buchanan and his colleagues and students at the University of Cardiff; and to Richard Coccia and the Coccia family 98 Screen 50:1 Spring 2009 Laura U Marks Information, secrets, ... weep and sleep; Dreymann plays music on the piano; he and Sieland make love and gently touch each other It is filmed in warm tones that emphasize the perceptual richness of this...

Ngày tải lên: 19/02/2014, 17:20

... (Paris, France): 5forGulox (forward), 5¢-GGGGACAAGTTT GTACAAAAAAGCAGGCTTCGATGACGACGACAAG ATGAGCCCGATATGGAGTAATTGGCCT-3¢; and 3revGulox (reverse), 5¢-GGGGACCACTTTGTACAAGAAA GCTGGGTCTCAGGGACCGAGAACGCGCCGGGTGT ... as a direct electron acceptor The animal and plant l-gulonolactone oxidoreductases are also active towards the l-galactono-1,4-lactone substrate Only scarce data are available on...

Ngày tải lên: 07/03/2014, 12:20

... Nakano, Y. , Yoshida, Y. , Nakao, H., Yamashita, Y & Koga, T (2000) Genetic analysis of the gene cluster for the synthesis of serotype a-specific polysaccharide antigen in Actinobacillus actinomycetemcomitans ... encoding the biosynthesis of GDP-6-deoxy-D-talose nor its corresponding protein has been found Recently, we cloned and characterized a gene cluster involve...

Ngày tải lên: 17/03/2014, 10:20

... synthesis of novel materials and the development of new processes Solvothermal synthesis of novel materials Roy has described the challenge for synthesizing new materials to specification [32] Hydro- and ... Conclusion Solvothermal reactions appear to be important for either the synthesis of novel materials, the preparation of nanostructured particl...

Ngày tải lên: 20/03/2014, 13:08

... methodology for the generation of personalized computational models of visual aesthetics (and content which is driven by those models) in the literature As this methodology builds upon the adaptation of ... the visual properties being evaluated and the process of adapting an aesthetic model to player choices Section V presents results of offline (non-interactive) opt...

Ngày tải lên: 23/03/2014, 13:20

... to Speech, incomplete draft, undergroland press, 1979 Chomsky, N., and Halle, M., The Sound Pattern of English, Harper and Row, 1968 Church, K., Stress Assignment in Letter to Sound Rules for Speech ... support the the stress neutral theory because they never receive main stress But, they can also be accounted for under the compound theory because they form nouns, and the...

Ngày tải lên: 31/03/2014, 17:20

... al for amorphous titania nanotubes [30] However, the annealed titania nanotubes are crystalline (mostly anatase) and show varied activity depending on the material preparation and annealing atmosphere ... (3.3 mA/cm2 ; Fig 13) This is due to the lower band gap of carbon-doped titania nanotubes compared with N2 - and O2 annealed nanotubes The lower the band gap of...

Ngày tải lên: 05/05/2014, 15:26

... capping CuO, AP-Fe2O3, AP-Al2O3 and AP -CaO [15­ agent was reported Then, we have focused 20] There are several methods for the synthesis our attention on the CaO nanoparticles/ of nanoscale CaO, including ... (2013) GC analysis illustrated that 75% and 100% of 2-CEPS For the evaluation of the reaction of 2-CEPS in contact to the CaO NPs with weight ratio as a...

Ngày tải lên: 06/05/2014, 08:55

... patterns of the ZnO sample synthesized at 120 ◦C for 17 h hydrothermal treatment Figure a b d e c f Fig SEM images of the time-dependent evolution in the formation of 3D flower-like ZnO synthesized ... of the formation process of the 3D flower-like ZnO Figure Fig (a) Bar graph illustration of the photocatalytic degradation of KGL using ZnO samples s...

Ngày tải lên: 06/05/2014, 13:26

... Zribi • Jeffrey Fortin Editors Functional Thin Films and Nanostructures for Sensors Synthesis, Physics, and Applications Editors Anis Zribi United Technologies Corporation Fire and Security Kidde ... design considerations related to the use of functional thin films and nanostructures, and specific case studies of functional thin films and nanostructure...

Ngày tải lên: 04/06/2014, 15:14

... Surface area of the catalyst before and after use in the reaction was measured using surface area & pore size analyzer (NOVA 1000e, Quanta chrome Instruments) All the chemicals were used as-received ... [6], amines [7], and synthesis of azaheterocycles [8] are some of the synthetic applications of oximes They are also useful for selective a- activation [9] and are ext...

Ngày tải lên: 20/06/2014, 22:20