Analysis and semi automated detection of design level similarity patterns in software

Analysis and semi automated detection of design level similarity patterns in software

Analysis and semi automated detection of design level similarity patterns in software

... A., and Jarzabek, S Detecting higher -level similarity patterns in programs In Proceedings of the European Software Engineering Conference and ACM SIGSOFT Symposium on the Foundations of Software ... Chapter Introduction With the ever increasing role of computing in all aspects of life, more and more software is being created A large part of the software cos...

Ngày tải lên: 15/09/2015, 17:09

199 481 0
A contrastive analysis of linguistic and socio cultural features of words denoting male characteristics in english and vietnamese

A contrastive analysis of linguistic and socio cultural features of words denoting male characteristics in english and vietnamese

... "chairman", "spokesman" and "businessman" The words "human, mankind" also contains elements “man” The study A Contrastive Analysis of Linguistic and SocioCultural Features of Words Denoting Male ... and adverb - The grammatical, semantic, pragmatics and sociocultural features of words denoting female characteristics - The grammatical, semantic, pragmatics...

Ngày tải lên: 26/11/2013, 13:31

13 930 0
Báo cáo khoa học: Molecular cloning, expression analysis and functional confirmation of ecdysone receptor and ultraspiracle from the Colorado potato beetle Leptinotarsa decemlineata pdf

Báo cáo khoa học: Molecular cloning, expression analysis and functional confirmation of ecdysone receptor and ultraspiracle from the Colorado potato beetle Leptinotarsa decemlineata pdf

... L decemlineata (b) the analysis of mRNA expression profile of L decemlineata, EcR and USP, and (c) the measurement of the binding affinity of steroidal and nonsteroidal ecdysone agonists to the ... hormone receptors of L decemlineata agonists for the molecular interaction with the molting hormone receptor Here, we report (a) the determination of pr...

Ngày tải lên: 07/03/2014, 21:20

15 564 0
Báo cáo sinh học: " Development of a real-time QPCR assay for the detection of RV2 lineage-specific rhadinoviruses in macaques and baboons" docx

Báo cáo sinh học: " Development of a real-time QPCR assay for the detection of RV2 lineage-specific rhadinoviruses in macaques and baboons" docx

... 5'-CCGTAGGCGATGGTCGTCCTAACRAAYTGNGG-3' 5'-TACAAAATACAGCGAGTGATANATRAARCA-3' ORF 59 (RFHV/KSHV)7 5'-TGAAAATCCACAGGCATGAT-3' 1The terminal "a" or "b" in the primer name indicates the plus or minus sense of the gene transcription, ... at the WaNPRC DNA samples were obtained from PBMC of a random assortment of thirty macaques housed at the WaNPRC and analyzed using the...

Ngày tải lên: 18/06/2014, 22:20

12 510 0
báo cáo hóa học:" Development of a real-time QPCR assay for the detection of RV2 lineage-specific rhadinoviruses in macaques and baboons" pot

báo cáo hóa học:" Development of a real-time QPCR assay for the detection of RV2 lineage-specific rhadinoviruses in macaques and baboons" pot

... at the WaNPRC DNA samples were obtained from PBMC of a random assortment of thirty macaques housed at the WaNPRC and analyzed using the standard RV2 and OSM QPCR assays While all of the samples ... 5'-CTTGCCAACGATTACATTTCCAGRGAYGARCT-3' 5' CTGGCTAACGACTACATCTCCAGRGAYGARCT-3' 5'-GGCAGTTTCAAGGCTGTGAATTTYTTYGARCG-3' 5'-CCGTAAGAAATGGTGGTCCTGACRAAYTGNGG-3' 5'-CCGTAGGCGATG...

Ngày tải lên: 20/06/2014, 04:20

12 471 0
Báo cáo hóa học: " Research Article Stability Analysis and Intermittent Control Synthesis of a Class of Uncertain Nonlinear Systems" doc

Báo cáo hóa học: " Research Article Stability Analysis and Intermittent Control Synthesis of a Class of Uncertain Nonlinear Systems" doc

... intermittent control, and some exponential stability criteria are established Finally, some conclusions and remarks are drawn in Section Problem Formulation and Preliminaries Consider a class of nonlinear ... ≥ to denote a positive negative, seminegative, and semipositive definite matrix P Journal of Inequalities and Applications Exponential Stabilization of a C...

Ngày tải lên: 21/06/2014, 06:20

13 444 0
Label free and reagentless electrochemical detection of microRNAs using a conducting polymer nanostructured by carbon nanotubes application to prostate cancer biomarker mir 141

Label free and reagentless electrochemical detection of microRNAs using a conducting polymer nanostructured by carbon nanotubes application to prostate cancer biomarker mir 141

... NH2–CCATCTTTACCAGACAGTGTTA 3′ 3′ GGUAGAAAUGGUCUGUCACAAU 5′ 3′ UUGUGACUAAAGUUUACCACGAU 5′ 3′AGUAUC GGGACAUGUUACGACGA 5′ 166 H.V Tran et al / Biosensors and Bioelectronics 49 (2013) 164–169 2.5 Grafting ... formats (Xu et al., 2004, 2006; Cai et al., 2003) In this paper, we describe a label- free and reagentless miRNA sensor based on an interpenetrated network of carbon nanotube...

Ngày tải lên: 02/07/2014, 14:14

6 298 0
Báo cáo khoa học: "Study protocol of the German "Registry for the Detection of Late Sequelae after Radiotherapy in Childhood and " ppsx

Báo cáo khoa học: "Study protocol of the German "Registry for the Detection of Late Sequelae after Radiotherapy in Childhood and " ppsx

... risks of radiotherapy in childhood and adolescence Methods/Design To overcome the described lack of information and to receive detailed data regarding the risk of radiotherapy in childhood and ... the German Group of Paediatric Radiation Oncology (APRO), a working group of the "German Society of Radiation Oncology" (DEGRO) and the "German Society...

Ngày tải lên: 09/08/2014, 09:22

4 397 0
Báo cáo sinh học: "Optimal design for the detection of a major gene segregation in crosses" potx

Báo cáo sinh học: "Optimal design for the detection of a major gene segregation in crosses" potx

... give a similar power for a dominant gene, the F2 must be used in the case of an additive gene, with a power varying between 60 and 70% against 30 to 40% for the backcross In the Cl situations the ... In the Cl cases, the backcrosses were not produced and the segregation of the major gene was visible only in the F2 In the C2 cases, the F2...

Ngày tải lên: 09/08/2014, 18:21

11 368 0
Báo cáo y học: "Detection of poliovirus by ICC/qPCR in concentrated water samples has greater sensitivity and is less costly using BGM cells in suspension as compared to monolayers" pot

Báo cáo y học: "Detection of poliovirus by ICC/qPCR in concentrated water samples has greater sensitivity and is less costly using BGM cells in suspension as compared to monolayers" pot

... this article as: Balkin and Margolin: Detection of poliovirus by ICC/ qPCR in concentrated water samples has greater sensitivity and is less costly using BGM cells in suspension as compared to ... following day by inverted phase contrast microscopy As expected the monolayers were unaffected, where as in the tubes, cellular debris and bo...

Ngày tải lên: 12/08/2014, 01:22

4 241 0
báo cáo khoa học: " Characterization of PR-10 genes from eight Betula species and detection of Bet v 1 isoforms in birch pollen" pot

báo cáo khoa học: " Characterization of PR-10 genes from eight Betula species and detection of Bet v 1 isoforms in birch pollen" pot

... 18 4 3 2 10 1 1 1 1 2 2 1 22 12 17 10 Subgenus Betulenta: B lenta 10 6 3 4 1 - - 1 14 11 10 3 10 2 10 3 10 6 - - 4 4 - 2 3 5 - 3 2 - 1 1 2 2 - 1 1 - - - - 20 16 20 17 - 17 11 12 11 13 Subgenus Betula: ... 17 % - Isoform Gene 01A 01 1A Ia: n.q IIIa: 51 IVa: 10 0 Va: 46 VIIa: 75 01A06 1A Ia: n.q IIIa: 51 IVa: 10 0 Vb: 23 VIIa: 75 01B 01 1B Ib: 69 IIIb: 1...

Ngày tải lên: 12/08/2014, 03:20

15 349 0
Báo cáo y học: "Genome analysis and genome-wide proteomics of Thermococcus gammatolerans, the most radioresistant organism" potx

Báo cáo y học: "Genome analysis and genome-wide proteomics of Thermococcus gammatolerans, the most radioresistant organism" potx

... genome analysis of T gammatolerans EJ3 and a detailed comparison with other Thermococcales genomes To gain real insights into the physiology of T gammatolerans, we analyzed the proteome content of ... plasticity in Thermococcales The six closely related and fully sequenced Thermococcales species (three Thermococcus, T gammatolerans, T kodakaraensis, and T onnurineus,...

Ngày tải lên: 14/08/2014, 21:20

23 513 0
New approaches to automated annotation of pathology level findings in medical images

New approaches to automated annotation of pathology level findings in medical images

... histogram of an image, a list of responses to a set of filter banks, or simply a list of intensities by stacking the columns of an image into a single vector One of the main advantages of vector ... methods in annotating natural images and the challenges in applying to the medical imaging domain We will end the chapter with a discussion of using existing techniques...

Ngày tải lên: 10/09/2015, 09:24

152 450 0
STABILITY ANALYSIS AND VOLTAGE SAG MITIGATION OF POWER SYSTEM IN OFFSHORE OIL RIG PLATFORM

STABILITY ANALYSIS AND VOLTAGE SAG MITIGATION OF POWER SYSTEM IN OFFSHORE OIL RIG PLATFORM

... STABILITY ANALYSIS AND VOLTAGE- SAG MITIGATION OF POWER SYSTEM IN OFFSHORE OIL RIG PLATFORM WU DI B Eng (Hons.), NUS A THESIS SUBMITTED FOR THE DEGREE OF MASTER OF ENGINEERING DEPARTMENT OF ... semi-submersible offshore oil rig platform uses variable-speed induction motors for station—keeping during drilling and sailing During drilling, the platform...

Ngày tải lên: 13/10/2015, 15:55

98 421 0
Từ khóa:
w