Development of a network integrated feature driven engineering environment

Development of a network integrated feature driven engineering environment

Development of a network integrated feature driven engineering environment

... that of a typical application context of a CAD framework Instead of identifying all aspects of the analogy between them, the focus was placed on characterizing the relationship among a group of ... conceptually applicable to the development of an integrated engineering environment for products which have a feature- driven process? • What are the adaptations that...

Ngày tải lên: 15/09/2015, 17:09

230 351 0
Design and development of a bioreactor for ligament tissue engineering

Design and development of a bioreactor for ligament tissue engineering

... (lateral collateral ligament and medial collateral ligament) , and two interior ligaments (anterior cruciate ligament (ACL) and posterior cruciate ligament) , which help control stabilisation and ... Rotating Wall Bioreactor 28 2.2.2.3 The Flow Perfusion Bioreactor 29 CHAPTER 3: DESIGN AND FABRICATION OF BIAXIAL MECHANICAL STIMULATION AND PERFUSION BIOREACTOR 32 3....

Ngày tải lên: 04/10/2015, 10:25

141 240 0
Development of a bioreactor for in vitro engineering of soft tissues

Development of a bioreactor for in vitro engineering of soft tissues

... DEVELOPMENT OF A BIOREACTOR FOR IN- VITRO ENGINEERING OF SOFT TISSUES KYAW MOE (B.Eng (Hons.), YTU, Yangon) A THESIS SUBMITTED FOR THE DEGREE OF MASTER OF ENGINEERING DEPARTMENT OF MECHANICAL ... through the chamber maintaining steady state Low inlet gas flow rates were maintained such that inexpensive commercially available CO2, O2, and N2 tanks would last f...

Ngày tải lên: 04/10/2015, 15:46

151 253 0
Báo cáo y học: " A validity-driven approach to the understanding of the personal and societal burden of low back pain: development of a conceptual and measurement model" doc

Báo cáo y học: " A validity-driven approach to the understanding of the personal and societal burden of low back pain: development of a conceptual and measurement model" doc

... A validity-driven approach to the understanding of the personal and societal burden of low back pain: development of a conceptual and measurement model Rachelle Buchbinder1,2,*,#, Roy Batterham3,*, ... develop a conceptual and measurement model of the overall burden of low back pain from the individual’s perspective using a...

Ngày tải lên: 12/08/2014, 18:20

39 388 0
Phát triển mạng lưới chăm sóc sức khoẻ tim mạch   development of a cardiac care network in vietnam

Phát triển mạng lưới chăm sóc sức khoẻ tim mạch development of a cardiac care network in vietnam

... TM - H a nhập Quốc tế - Các Trung tâm TM - Các Khoa TM - Các Phân khoa TM Telesurgery Expert Telepathology Real-time Ultrasound Wide Area Grand Rounds Home Healthcare Teleradiology Telecardiology ... thống Chăm sóc Sức khỏe Tim mạch Việt nam - Mô hình bệnh tật - Đ a dư - Dân số - Giao thông - Văn h a - Kinh nghiệm giới - Nhà nước – Xã hội - Hài h a - Hướng cộng đồng - Hiện đại -...

Ngày tải lên: 22/08/2015, 20:17

18 172 0
Development of a bioresorbable bone graft alternative for bone engineering applications

Development of a bioresorbable bone graft alternative for bone engineering applications

... S, Bai HF, Gajadar B, Mia W, Amber S, Monica S, iv Sambit S, Amit K, Radek and Joanna, Sang Joon A, Tarik A, Anand L, staff of Bioengineering, Orthopaedic Surgery, DES SGH and NUSTEP For all ... sectioned and sawed through the implantation site for gross examination and biocage material retrieval Image shows all sample groups at months (A) Autograft: uniform bone trabeculae observed...

Ngày tải lên: 11/09/2015, 09:58

252 322 0
Development of a method to measure consumer emotions associated with foods

Development of a method to measure consumer emotions associated with foods

... Identify appropriate terms to measure emotions associated with foods maximizing information about the product Identify scaling approaches to measure emotions with consumers Develop a test protocol to ... included approximately equal percentages of males and females, and the age range was from 18 to 65 years of age Basically consumers are screened and recruited vi...

Ngày tải lên: 03/04/2013, 21:07

10 782 3
Development of a Regional Risk Management Framework for APEC Economies for use in the Control and Prevention of Introduced Marine Pests

Development of a Regional Risk Management Framework for APEC Economies for use in the Control and Prevention of Introduced Marine Pests

... Framework - Introd uced Marine Pests Phase – Consultancy  Identified current management capabilities and approaches  Priorities and hazards for APEC Economies  Considerations for a Risk Management ... Risk Management Framework  Conclusions, including the results of the November 2001 Workshop Management Framework - Introd uced Marine Pests Man...

Ngày tải lên: 28/10/2013, 11:15

10 584 0
Tài liệu Module 8: Concepts of A Network Load Balancing Cluster ppt

Tài liệu Module 8: Concepts of A Network Load Balancing Cluster ppt

... the Network Load Balancing driver architecture 2 Module 8: Concepts of A Network Load Balancing Cluster Network Load Balancing Concepts Topic Objective To give an overview of Network Load Balancing ... in a cluster Module 8: Concepts of A Network Load Balancing Cluster Network Load Balancing Topic Objective To introduce the...

Ngày tải lên: 18/01/2014, 05:20

44 541 0
Tài liệu Báo cáo khoa học: Development of a new method for isolation and long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse pdf

Tài liệu Báo cáo khoa học: Development of a new method for isolation and long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse pdf

... GAGATGGATAAAGTTTTAAACAGAG-3¢ and LTA1R, 5¢-TGAAGGCAAATCTCTGGAC-3¢ for the former, and LTA–M2F, 5¢-CAGCTGTTTTGCTTGAATTATG-3¢ and LTA–2R, 5¢-GAATTCATTATGTTTCAGGTTCA GGGG-3¢ for the latter The PCR products ... functions and intracellular signaling Thus, our system provides an accessible method to examine the endothelial cell biology of the mouse, and will accelerat...

Ngày tải lên: 18/02/2014, 17:20

11 873 0
Báo cáo " Development of a spectrometry system Using lock-in amplification technique " doc

Báo cáo " Development of a spectrometry system Using lock-in amplification technique " doc

... example, Raman Spectra of Vietnam petrol extracts excited by a 30mW He-Ne laser instead of Ion Argon laser The Raman excitation by He-Ne laser showed many advantages in comparison with Argon laser ... and may contain any number of embedded space characters A command to the SR830 consists of a four characters command mnemonic, arguments if necessary, and a command terminator Th...

Ngày tải lên: 05/03/2014, 14:20

6 524 0
Báo cáo khoa học: Functional expression of olfactory receptors in yeast and development of a bioassay for odorant screening docx

Báo cáo khoa học: Functional expression of olfactory receptors in yeast and development of a bioassay for odorant screening docx

... used for RT-PCR were: for the I7 OR (5¢-CGTCAAGGAGAAAAAACCCCGGATCT AAAAAATGGAGCGAAGGAACCACAG-3¢) and (5¢-AG CTGCCTGCAGGTCGACTCTAGAGGATCCTAACCAA TTTTGCTGCC-3¢); for OR17-40 (5¢-CGTCAAGGAG AAAAAACCCCGGATCTAAAAAATGGAGCAGAAAC ... recombination introducing the c-myc-OR17-40 coding sequence, using primers (5¢-CGTCAAGGAGAAAAAAC CCCGGATCTAAAAAATGGAGCAGAAACTCATCTC TGAAGAGGATCTG-3¢) and (5¢-G...

Ngày tải lên: 07/03/2014, 16:20

14 473 0
Báo cáo "Development of a software package for 3D structured mesh generation " pdf

Báo cáo "Development of a software package for 3D structured mesh generation " pdf

... the software package interface Fig The flowchart of the program for 3D structured elliptic mesh generation Results The software package developed has been tested and applied to the mesh generation ... input data and the output meshes The software package has been initially used as a tool for 3D structured mesh generation for simulations of compressi...

Ngày tải lên: 14/03/2014, 13:20

14 402 0
Báo cáo khoa học: The antagonistic effect of hydroxyl radical on the development of a hypersensitive response in tobacco pot

Báo cáo khoa học: The antagonistic effect of hydroxyl radical on the development of a hypersensitive response in tobacco pot

... in ltrated zones at the indicated time points (Fig 1D) The extent of the HR in the PR zone was significantly suppressed as compared with that in the ParA1 zone In the ParA1 zone, the ion leakage ... level after ParA1 treatment H2O, H2O pretreatment; H + ParA1, ParA1 in ltration after H2O treatment; A4 00, 400 lM ABA pretreatment; A + ParA1, ParA1 in ltration after A...

Ngày tải lên: 15/03/2014, 00:20

15 479 0
Từ khóa:
w