Complementary formalisms synthesis, verification and visualization
... logic-based formalisms and visual formalisms can be used to specify a wide range of systems [94, 43, 118, 55] In this thesis, we explored complementary interplays between logic-based and visual formalisms ... semantic-based transformations between logic-based and visual formalisms pursuing objectives including visualization and verification The lightweight and intuitive...
Ngày tải lên: 15/09/2015, 17:09
Verification and Validation
... Engineering, 7th edition Chapter 22 Slide 11 Testing and debugging Defect testing and debugging are distinct processes Verification and validation is concerned with establishing the existence ... edition Chapter 22 Slide 44 Key points Verification and validation are not the same thing Verification shows conformance with specification; validation shows that th...
Ngày tải lên: 14/09/2012, 11:41
... 2001 37 Product Version 4.0.8 Synthesis Place-and-Route (SP&R) Flow Guide RTL Synthesis May 2001 38 Product Version 4.0.8 Synthesis Place-and-Route (SP&R) Flow Guide Floorplanning This chapter ... Product Version 4.0.8 Synthesis Place-and-Route (SP&R) Flow Guide Synthesis, Placement, and Optimization May 2001 48 Product Version 4.0.8 Synthesis Place-a...
Ngày tải lên: 12/12/2013, 23:15
... gtgactgcag gaaggggatc cggctgctaa caaagcccga 280 281 aaggaagctg agttggctgc tgccaccgct gagcaataac 320 321 tagcataccc 361 TTTTTGCTGA cttggggcct AAGGAGGAAC ctaaacgggt TATATCCGGA cttgaggggt TATCCCGCAA ... taagacttttttacggcggcgctatcgctaacgggcccgcgc attctgaaaaaatgccgccgcgatagcgattgcccgggcgcg I L K K C R R D S D C P G A acgtaaacggcgccgttgccgataacgccgattgagctcggc tgcatttgccgcggcaacggctattgcggctaactc...
Ngày tải lên: 12/02/2014, 10:20
Tài liệu Báo cáo khoa học: Insights into and speculations about snake venom metalloproteinase (SVMP) synthesis, folding and disulfide bond formation and their contribution to venom complexity pdf
... [9] Superficially, one could simply Snake venom metalloproteinases and venom complexity attribute venom complexity to genomic ⁄ transcriptomic complexity, and to a certain degree this is the case ... 2008 FEBS 3017 Snake venom metalloproteinases and venom complexity J W Fox and S M T Serrano proteins are synthesized in the cytoplasm of secretory cells in the gl...
Ngày tải lên: 18/02/2014, 18:20
Large scale synthesis, characterization and photoluminescence properties of amorphous silica nanowires by thermal evaporation of silicon monoxide
... single step process using thermal evaporation of silicon monoxide under argon atmosphere with traces of oxygen The nanowires were free from metal contaminations and showed blue photoluminescence at ... its simplicity and the low cost Conclusions Amorphous silicon dioxide nanowires of several hundred microns in length and tens of nanometers in diameter have been...
Ngày tải lên: 16/03/2014, 15:18
Báo cáo Y học: Synthesis, characterization and application of two nucleoside triphosphate analogues, GTPcNH2 and GTPcF pdf
... lower hydrolysis rates were the two triphosphate analogues with b,c-substitutions GppCH2p and GppNHp The Ras-catalysed hydrolysis rate of GTPcNH2 finally lay midway between the rates for GTPcS and ... c-Fluoroadenosine triphosphate Synthesis, properties, and interaction with myosin and heavy meromyosin Biochemistry 11, 2863–2871 34 Pfeuffer, T & Eckstein, F (1976) Topology...
Ngày tải lên: 18/03/2014, 01:20
influence of dopant in the synthesis, characteristics and ammonia sensing behavior
... our investigation on the comparative study of the extent of intermolecular force, chain association and morphology of the single and co-doped PANI and the direct effects on their conductivity and ... the vibrational bands of the dopant ion and the characteristic bands of PANI indicates that the deposited PANI on the PVA matrix is in the emeraldine s...
Ngày tải lên: 20/03/2014, 13:04
quasi - one - dimensional metal oxide materials — synthesis, properties and applications
... sensing based on metal oxide nanowires, such as zinc oxide (ZnO), tin oxide (SnO2), indium oxide (In2O3) aluminum oxide (Al2O3), gallium oxide (Ga2O3), tungsten oxide (WO3), and vanadium oxide (V2O5) ... behavior is the most important and well-known property of metal oxide materials In addition to the sensitivity to light and pressure as mentioned in previous sec...
Ngày tải lên: 20/03/2014, 13:06
synthesis, characterization and growing mechanism of monodisperse fe3o4 microspheres
... condition of the microspheres shown in Fig 1c The surface of microspheres was made of a number of small subunits, each of which is like a tetrahedron crystal in shape and uniform in size and packed ... formation of homogeneous and tight Fe3O4 In contrast, pH values in NaOH system changed all through and decreased with the nucleation time of forming Fe3O4, and fu...
Ngày tải lên: 20/03/2014, 13:08
synthesis, structure and magnetic properties of iron-doped tungsten oxide nanorods
... profiles of the Fe-doped tungsten oxide nanorods after annealing in air The inset shows the morphology of the annealed sample and the area for recording EDX spectrum other iron oxides because of the ... in different iron oxides In order to determine the magnetization contribution of different magnetic phases, a basic knowledge for the magnetic properties of bulk Fe and...
Ngày tải lên: 20/03/2014, 13:08
Báo cáo khoa học: Methylcitrate synthase from Aspergillus fumigatus Propionyl-CoA affects polyketide synthesis, growth and morphology of conidia ppt
... protocol and use of bovine serum albumin as a standard Biochemical characterization of A fumigatus methylcitrate synthase Methylcitrate synthase and citrate synthase activities were assayed with propionyl-CoA ... appearing from N-terminal sequencing The overall identity of the methylcitrate synthases from A nidulans and A fumigatus was 88% Identification of...
Ngày tải lên: 23/03/2014, 15:20
Báo cáo khoa học: "TOWARDS AN INTEGRATED ENVIRONMENT FOR SPANISH DOCUMENT VERIFICATION AND COMPOSITION" pptx
... grammar students, and other ideas include automatic document abstracting, storage and retrieval, inclusion of dictionary definitions and translation into other languages, and document style critiquing ... additional marks for hyphenation points (for later use by a formatter performing automatic syllable partition), and several other for foreign and Latin words, geographic...
Ngày tải lên: 24/03/2014, 05:21