Structural and functional genomics study of singapore grouper iridovirus 2

Structural and functional genomics study of singapore grouper iridovirus 2

Structural and functional genomics study of singapore grouper iridovirus 2

... gi|566 926 44 ORF007L ORF012L SGIV protein 323 09 .26 iTRAQ ratio (MO18/ MOctrl) 0.379483 gi|566 926 49 ORFs/ Protein name Protein MW (Da) 129 768.6 0.6634 02 2 629 8 .25 0.579507 23 111.84 0.573601 gi|566 926 83 ... C., Wang F., and Hew C L 20 04 Functional genomics analysis of Singapore grouper iridovirus: complete sequence determination and proteomic analysis Journal of...

Ngày tải lên: 14/09/2015, 14:11

40 265 0
Structural and functional genomics study of singapore grouper iridovirus 1

Structural and functional genomics study of singapore grouper iridovirus 1

... ds DNA 13 3894 bp 15 4 ORFs L22858 Ayres et al., 19 94 ds DNA 13 9342 bp 14 1 ORFs AF32 515 5 Pang et al., 20 01 ds DNA 15 8482 bp 16 8 ORFs AY126275 Li et al., 2002 ds DNA 12 8 413 bp 13 6 ORFs NC_0 019 62 Gomi ... Yes Putative E3 Singapore grouper iridovirus SGIV Ranavirus 14 013 1 16 2 AY5 216 25 Yes Putative E3 Infectious spleen and kidney necrosis virus ISKNV Megalocy...

Ngày tải lên: 14/09/2015, 14:11

100 284 0
Functional and structural genomics study of singapore grouper iridovirus

Functional and structural genomics study of singapore grouper iridovirus

... Chloriridovirus and, Lymphocystivirus and Ranavirus (Chinchar et al., 2005) 1.3 Introduction of Singapore grouper iridovirus (SGIV) In 1994, a novel member of Ranavirus, Singapore grouper iridovirus ... …………………………………………………………….……27 Chapter iTRAQ study of Grouper embryonic cells infected by Singapore grouper Iridovirus: an insight into the Singapore grouper i...

Ngày tải lên: 11/09/2015, 16:04

143 162 0
Functional and structural study of singapore grouper iridovirus ORF086R

Functional and structural study of singapore grouper iridovirus ORF086R

... FUNCTIONAL AND STRUCTURAL STUDY OF SINGAPORE GROUPER IRIDOVIRUS ORF086R YAN BO (B.Sc., Xiamen University,China) A Thesis Submitted For The Degree Of Master Of Science Department of Biological ... -55 Figure3.20 CD study of ORF086R( 1-85) 57 Figure3.21 DLS study of ORF086R( 1-85) 57 Figure3.22 1D NMR study of ORF086R ... process of mature virus Due t...

Ngày tải lên: 13/10/2015, 16:41

89 179 0
unctional genomic study of singapore grouper iridovirus

unctional genomic study of singapore grouper iridovirus

... Sea bream iridovirus Taiwan grouper iridovirus Olive flounder iridovirus Rock bream iridovirus White sturgeon iridovirus Unassigned 1.1.2 Structure of the Iridoviruses Iridoviruses are icosahedral ... mass fingerprinting Q-TOF quadrupole-TOF RACE rapid amplification of cDNA ends RBIV rock bream iridovirus RNAi RNA interference RNase ribonuclease SGIV Singapore grouper i...

Ngày tải lên: 12/09/2015, 08:16

147 207 0
Tài liệu Báo cáo khoa học: Structural and functional specificities of PDGF-C and PDGF-D, the novel members of the platelet-derived growth factors family docx

Tài liệu Báo cáo khoa học: Structural and functional specificities of PDGF-C and PDGF-D, the novel members of the platelet-derived growth factors family docx

... PDGF-C and -D, structure and function L J Reigstad et al endothelial growth factors (VEGF) and the family is therefore often referred to as the PDGF ⁄ VEGF family The PDGF family of growth factors ... however further understanding of how these factors interplay with other members of the cystine knot family and in particular the PDGF-A, -B, and V...

Ngày tải lên: 19/02/2014, 07:20

19 558 0
Ant functional group succession dynamics correlates with the age of vegetation succession data analysis of worldwide studies and a case study of a secondary tropical rain forest in singapore

Ant functional group succession dynamics correlates with the age of vegetation succession data analysis of worldwide studies and a case study of a secondary tropical rain forest in singapore

... FOREST OF SINGAPORE Introduction The main island of Singapore is located off the southern tip of the Malay Peninsula and most of the island consisted of tropical lowland rain forest for much of the ... demonstrated this pattern of functional group succession by conducting a study of the ant community within a secondary tropical rain...

Ngày tải lên: 29/09/2015, 13:01

109 536 0
Báo cáo y học: "Functional genomics analysis of low concentration of ethanol in human hepatocellular carcinoma (HepG2) cells. Role of genes involved in transcriptional and translational processes"

Báo cáo y học: "Functional genomics analysis of low concentration of ethanol in human hepatocellular carcinoma (HepG2) cells. Role of genes involved in transcriptional and translational processes"

... ethanol- regulated genes were involved using KEGG (Kyoto Encyclopedia of Genes and Genomes) [36] and GenMAPP (Gene Microarray Pathway Profiler) [37] analysis As shown in Table 2, only ITGB4 was found to be involved ... considering the reported high expression of the ankyrin-repeat oncoprotein (gankyrin) in human hepatocellular carcinoma Gankyrin binds to the cell-...

Ngày tải lên: 31/10/2012, 15:28

8 704 0
Tài liệu Báo cáo khoa học: Structural and functional studies of the human phosphoribosyltransferase domain containing protein 1 docx

Tài liệu Báo cáo khoa học: Structural and functional studies of the human phosphoribosyltransferase domain containing protein 1 docx

... S103 G145/D137 Y 112 D2 01/ 193 L75/67 G145/D137 E1 41/ 133 K173 /16 5 R207 /19 9 G77/69 D142 /13 4 G197 /18 9 Fig Superposition of PRTFDC1 with HPRT-ImmGP (Protein Data Bank code: 1BZY) (A) Residues in the ... Welin et al Studies of the human PRTFDC1 B A PRTFDC1 25 HPRT 20 10 00 0.2 800 600 400 0 .1 200 –50 50 10 10 50 10 015 0 200 250 S 200 –50 250 50 12 00 10 0 15 0 [H...

Ngày tải lên: 15/02/2014, 01:20

11 770 0
Tài liệu Báo cáo khoa học: Studies on structural and functional divergence among seven WhiB proteins of Mycobacterium tuberculosis H37Rv pdf

Tài liệu Báo cáo khoa học: Studies on structural and functional divergence among seven WhiB proteins of Mycobacterium tuberculosis H37Rv pdf

... properties of WhiB2 , WhiB5 , WhiB6 and WhiB7 of M tuberculosis and also compare the properties of all seven WhiB proteins We show that, similar to WhiB3 and WhiB4 , other freshly purified WhiB proteins ... preparations) A + – + – + + + + – + + + + + + + + + 10X 10X 10X 10X 10X 0.1X WhiB IscS 35S-Cys Samples Atoms of iron per monomer WhiB1 WhiB1 WhiB1 WhiB...

Ngày tải lên: 18/02/2014, 12:20

18 548 0
Tài liệu Báo cáo khoa học: Interleukin-1-inducible MCPIP protein has structural and functional properties of RNase and participates in degradation of IL-1b mRNA doc

Tài liệu Báo cáo khoa học: Interleukin-1-inducible MCPIP protein has structural and functional properties of RNase and participates in degradation of IL-1b mRNA doc

... that MCPIP regulates the amount of IL-1b mRNA Involvement of PIN domain of MCPIP in the stability of IL-1b mRNA In order to find out whether the PIN domain in MCPIP is responsible for IL-1b mRNA ... interacting with MCPIP will clarify the dynamics and features of this protein Role of MCPIP in regulation of the endogenous IL-1b transcript level...

Ngày tải lên: 18/02/2014, 14:20

14 598 0
Tài liệu Báo cáo khoa học: Structural and functional investigations of Ureaplasma parvum UMP kinase – a potential antibacterial drug target ppt

Tài liệu Báo cáo khoa học: Structural and functional investigations of Ureaplasma parvum UMP kinase – a potential antibacterial drug target ppt

... UMPK The F133N mutation was created using UMP kinase from Ureaplasma parvum the following primers: F133N-fw (5¢-GATTTTTGTGGCT GGAACAGGAAACCCATATTTTACAACTGATTCG) and F133N-rv (5¢-CGAATCAGTTGTAAAATATGGGT ... with ADP and UDP, and ADP showed a rate that was > 20 times that of UDP In order to determine the true Km for UMP and ATP, a two-substrate assay was performed at fou...

Ngày tải lên: 18/02/2014, 16:20

12 657 0
Báo cáo khoa học: Structural and functional aspects of unique type IV secretory components in the Helicobacter pylori cag-pathogenicity island potx

Báo cáo khoa học: Structural and functional aspects of unique type IV secretory components in the Helicobacter pylori cag-pathogenicity island potx

... loop, the first and last turns of helices E and F, and the C-terminus helices I and J In addition, there is a lysine-rich N- and C-terminus, in accordance with the basic isoelectric point of CagS ... as that of other members of this family Finally, when crystallized in the presence of Cu(II), the protein shows the presence of the ion coordinated in a...

Ngày tải lên: 06/03/2014, 00:21

9 496 0
Báo cáo khoa học: Glutamic acid residues in the C-terminal extension of small heat shock protein 25 are critical for structural and functional integrity pptx

Báo cáo khoa học: Glutamic acid residues in the C-terminal extension of small heat shock protein 25 are critical for structural and functional integrity pptx

... Frequency of amino acid residues in the flexible region of the C-terminal extensions of human and murine sHsps Residues present in the flexible region of the C-terminal extension of each of the eight ... examined the role of residues in the C-terminal extensions of other sHsps, notably aA- and aB-crystallin, the flexible regions of thes...

Ngày tải lên: 07/03/2014, 04:20

14 417 0
Báo cáo khoa học: Structural and functional roles for b-strand 7 in the a-crystallin domain of p26, a polydisperse small heat shock protein from Artemia franciscana pdf

Báo cáo khoa học: Structural and functional roles for b-strand 7 in the a-crystallin domain of p26, a polydisperse small heat shock protein from Artemia franciscana pdf

... 5¢-CGTCGTCGAAATTCTCCTTGTACGTGTCC-3¢ 5¢-CACGTACAAAGAGAACGTCGACGACG-3¢ 5¢-CGTCGTCGACGTTCTCTTTGTACGTG-3¢ 5¢-GAGAATTTCGAGCACGATACAGACTCCC-3¢ 5¢-GGGAGTCTGTATCGTGCTCGAAATTCTC-3¢ 5¢-CGACGACGAGACAGACTCCCAGAACATGTC-3¢ 5¢-GACATGTTCTGGGAGTCTGTCTCGTCGTCG-3¢ ... investigated by site-directed mutagenesis of a- crystallin domain residues and molecular modeling of protein structure The p26 a...

Ngày tải lên: 07/03/2014, 12:20

15 516 0
w