NMR study of the human NCK2 SH3 domains structure determination, binding diversity, folding and amyloidogenesis 7

NMR study of the human NCK2 SH3 domains structure determination, binding diversity, folding and amyloidogenesis 7

NMR study of the human NCK2 SH3 domains structure determination, binding diversity, folding and amyloidogenesis 7

... 7. 2 Future work 1) Structure determinations and study of binding diversity are carried out for both SH3- 2 and SH3- 3 domain in this project However, whether the hydrogen bond ... between SH3 and proline-rich peptides The dynamic information of loops and 310-helix in the complex system will give us more functional implication 3) If the solubility and stabilit...
Ngày tải lên : 14/09/2015, 14:10
  • 2
  • 141
  • 0
NMR study of the human NCK2 SH3 domains structure determination, binding diversity, folding and amyloidogenesis 1

NMR study of the human NCK2 SH3 domains structure determination, binding diversity, folding and amyloidogenesis 1

... properties of the hNck2 SH3 domains 1. 5.2 Secondary structure transition study of hNck2 SH3- 1 domain The unfolding of SH3- 1 induced by the pH change and transition from the β-sheet dominant to the helical ... main binding region of DOCK180 was located at region 18 19 -18 36 In addition, two of the other weak binding sites were pinpointed at the...
Ngày tải lên : 14/09/2015, 14:09
  • 44
  • 186
  • 0
NMR study of the human NCK2 SH3 domains structure determination, binding diversity, folding and amyloidogenesis 2

NMR study of the human NCK2 SH3 domains structure determination, binding diversity, folding and amyloidogenesis 2

... relaxation delays of 10, 30, 45, 60, 75, 90 and 150ms 15 N T1 and T2 relaxation times and {1H}-15N steady-state NOEs of SH3- 1-V 22 52 (insertion of Val at 22 nd) were determined at 20 °C 15 N T1 values ... delays of 10, 500, 50, 300, 100, 400 and 20 0ms 15 N T2 values were determined with relaxation delays of 10, 50, 80, 120 , 150, 180, 21 0, 23 0 and 25 0 ms 15...
Ngày tải lên : 14/09/2015, 14:09
  • 9
  • 149
  • 0
NMR study of the human NCK2 SH3 domains structure determination, binding diversity, folding and amyloidogenesis 3

NMR study of the human NCK2 SH3 domains structure determination, binding diversity, folding and amyloidogenesis 3

... characteristic of all SH3 domains Figure 3. 3C shows a superimposition of hNck2 SH3- 2 and Nck1 SH3- 2 domains recently 60 Figure 3. 2 HSQC and sequential assignments of SH3- 2 and SH3- 3 A shows the HSQC and ... 0 .37 Secondary structure regions 64 3. 2.2 HSQC identification of the residues involved in binding of the hNck2 SH3 Domains The inte...
Ngày tải lên : 14/09/2015, 14:09
  • 34
  • 236
  • 0
NMR study of the human NCK2 SH3 domains structure determination, binding diversity, folding and amyloidogenesis 4

NMR study of the human NCK2 SH3 domains structure determination, binding diversity, folding and amyloidogenesis 4

... β-sheets The first, the last and the first half of the second β-strand constitute the first β-sheet, whereas the second half of the second β-strand, together with the third and fourth β-strands constitutes ... with the lowest target function and its ensemble of ten structures superimposed over residues 32 44 Right: Ribbon representation of the NMR structur...
Ngày tải lên : 14/09/2015, 14:10
  • 27
  • 207
  • 0
NMR study of the human NCK2 SH3 domains structure determination, binding diversity, folding and amyloidogenesis 5

NMR study of the human NCK2 SH3 domains structure determination, binding diversity, folding and amyloidogenesis 5

... HG Val53 HN Tyr52 HN Glu54 HN Arg 55 HN Glu54 HN Val53 HN Glu54 HN Tyr52 HB Arg 55 HN Val53 HG Arg 55 HN Val53 HB Table 5. 2 Native like long range NOEs Between the first and second beta strands Val3 ... between the SH3- 1-V22 and WT at and 1H frequencies, especially at the N- and C-terminals of SH3- 1 1 25 Figure 5. 3 Assignments of SH3- 1-V22 at pH 4.0 and V22△...
Ngày tải lên : 14/09/2015, 14:10
  • 31
  • 164
  • 0
NMR study of the human NCK2 SH3 domains structure determination, binding diversity, folding and amyloidogenesis 6

NMR study of the human NCK2 SH3 domains structure determination, binding diversity, folding and amyloidogenesis 6

... both the CD and NMR spectra; the NMR titration experiment shows that the binding event mainly happens in the Cterminal of the ApLLP; 2) Consistent with the NMR study, the CD spectra show that there ... 159 Figure 6. 5 Bindings of the CRE DNA to two ApLLP proteins A–B) Superimposition of the 1H–15N NMR HSQC spectra of ApLLP-87, A) and ApLLP-55, B) in...
Ngày tải lên : 14/09/2015, 14:10
  • 18
  • 195
  • 0
Báo cáo khoa học: An NMR study of the interaction between the human copper(I) chaperone and the second and fifth metal-binding domains of the Menkes protein pot

Báo cáo khoa học: An NMR study of the interaction between the human copper(I) chaperone and the second and fifth metal-binding domains of the Menkes protein pot

... the tag and the remainder of the protein and that the solution structure of MNK5 is not sensitive to the presence of the tag Recombinant protein characterization, NMR frequency assignments and solution ... interaction of the chaperone with the second domain seems unlikely also in the case of ATP7B The selectivity, if any, for the interaction...
Ngày tải lên : 30/03/2014, 15:20
  • 7
  • 368
  • 0
Báo cáo khoa học: H NMR study of the molecular structure and magnetic properties of the active site for the cyanomet complex of O2-avid hemoglobin from the trematode Paramphistomum epiclitum pdf

Báo cáo khoa học: H NMR study of the molecular structure and magnetic properties of the active site for the cyanomet complex of O2-avid hemoglobin from the trematode Paramphistomum epiclitum pdf

... CbHs CdHs CeHs CfH NH CaH CbH CdHs CeHs NH CaH CbH CdH NH CaH CbH CdHs CeHs CfH NH CaH CbH CbHÂ CdHs CeHs OH NH CaH CbH3 NH CaH CbH CcH3 NH CaH CbH CbHÂ CcH CdH3 CdH3Â NH CaH CbH3 NH CaH CbH ... NH CaH CbH CbHÂ NdH NH CaH CbH CcH3 NH CaH CbH CcH3 CcH3Â NH CaH CbH CbH CdHs CfH NH CaH CaHÂ NH CbH CbHÂ CdHs CeHs CfH NH CaH CbH CdHs CeHs CfH NH CaH CbHs CcH CeH3 CaH CbH CcHs CcHÂ CdH3 3.25 ... po...
Ngày tải lên : 23/03/2014, 17:22
  • 14
  • 504
  • 0
Tài liệu Báo cáo khoa học: Characterization of promoter 3 of the human thromboxane A2 receptor gene A functional AP-1 and octamer motif are required for basal promoter activity docx

Tài liệu Báo cáo khoa học: Characterization of promoter 3 of the human thromboxane A2 receptor gene A functional AP-1 and octamer motif are required for basal promoter activity docx

... Prm3 was performed using the mutator primers Kin175 (5¢-CACCAGAGCTACTTACA CTGAATTCCAGAATAATCACAAGCAAATC -3 ; sense primer) vs its complement generating pGL3b:Prm3aOCT)1*, pGL3b:Prm3abOCT)1* and ... Prm3aaAP)1*, pGL3e:Prm3aaAP)1*, pGL3b:Prm3aaaAP)1* and pGL3e:Prm3aaaAP)1* Mutation of the Oct-1 element with the sequence aaA TGCa to aaTTCCa (core bases shown in uppercase letters) cen...
Ngày tải lên : 19/02/2014, 16:20
  • 18
  • 509
  • 0
Báo cáo y học: " Theoretical study of the Usutu virus helicase 3D structure, by means of computer-aided homology modelling" ppsx

Báo cáo y học: " Theoretical study of the Usutu virus helicase 3D structure, by means of computer-aided homology modelling" ppsx

... structure of the helicase enzyme of Usutu virus was modelled by applying homology modelling techniques and using the crystal structure of the Murray Valley Encephalitis virus helicase of the Flaviviridae ... 5C) Taken together these observations illustrated the viability of the homology modelling of the Usutu virus helicase model To evaluate fur...
Ngày tải lên : 13/08/2014, 16:21
  • 9
  • 348
  • 0
Báo cáo khoa học: NMR study of complexes between low molecular mass inhibitors and the West Nile virus NS2B–NS3 protease ppt

Báo cáo khoa học: NMR study of complexes between low molecular mass inhibitors and the West Nile virus NS2B–NS3 protease ppt

... been reported for the WNV NS2B–NS3 protease The poor quality of the NMR spectrum of WNV NS2B–NS3pro in the absence of inhibitors is reminiscent of the situation in the homologous NS2B–NS3pro construct ... 2009 The Authors Journal compilation ª 2009 FEBS 4253 NMR analysis of the West Nile virus protease 10 11 12 13 14 15 16 17 18 X.-C Su et al minant...
Ngày tải lên : 07/03/2014, 02:20
  • 12
  • 451
  • 0
Báo cáo khoa học: Purification and structural study of the b form of human cAMP-dependent protein kinase inhibitor pdf

Báo cáo khoa học: Purification and structural study of the b form of human cAMP-dependent protein kinase inhibitor pdf

... regulation of < /b> the < /b> PKI and < /b> PKI isoforms of < /b> the < /b> inhibitor protein of < /b> the < /b> cAMP-dependent protein kinase J Biol Chem 272, 20011–20020 Byler, D.M & Susi, H (1986) Examination of < /b> the < /b> secondary structure of < /b> proteins ... spectrum of < /b> human PKIb in H2O The < /b> quantitative contributions of < /b> the < /b> indi...
Ngày tải lên : 07/03/2014, 15:20
  • 6
  • 531
  • 0
Báo cáo khóa học: Structural characterization of the human Nogo-A functional domains Solution structure of Nogo-40, a Nogo-66 receptor antagonist enhancing injured spinal cord regeneration ppt

Báo cáo khóa học: Structural characterization of the human Nogo-A functional domains Solution structure of Nogo-40, a Nogo-66 receptor antagonist enhancing injured spinal cord regeneration ppt

... characterization of the Nogo -A functional domains (Eur J Biochem 271) 3513 Fig Schematic representation of the domain organization of the human Nogo -A protein (A) The domain organization of human ... fragments The Nogo -A cDNA (designated KIAA 0886) was obtained from the Kazusa DNA Research Institute (KazusaKamatari, Kisarazu, Chiba, Japan) A DNA fra...
Ngày tải lên : 16/03/2014, 16:20
  • 11
  • 493
  • 0
Từ khóa: