... 5¢-CATCTTGAAAGTCGGTGCGGGAGAAGCAA CACAATGC-3¢ (the reverse primer was the complementary sequence); pCA(E45 7A) forward primer, 5¢-CATCTTGA AAGTCGGTAAGGGAGCAGCAACACAATGC-3¢ (the reverse primer was the ... Simoes et al ˜ Cardosin A associates with phospholipase Da A Fig Cardosin A interacts with the C2 domain of PLDa Pull-down assays for cardosins A and B were per...
Ngày tải lên: 30/03/2014, 11:20
... in their approach to CEO compensation Comparisons of CEO compensation and firm performance in the U.S airline industry may aid those seeking to invest in the industry as well as forward looking ... CEO age and tenure and CEO shareholdings were used as measures of CEO compensation while ROE was adapted as a measure of firm performance The...
Ngày tải lên: 11/09/2013, 11:44
A contrastive analysis of linguistic features of the adjective black in english and đen in vietnamese
... are the pragmatic features of the adjective Black in English and Đen in Vietnamese? (4) What are the pragmatic similarities and differences of the adjective Black in English and Đen in Vietnamese? ... Describing the semantic features of the adjectives Black and Đen - Giving contrastive analysis of Black and Đen in terms...
Ngày tải lên: 26/11/2013, 13:29
The transference of meaning through class of words denoting parts of the human body in english and vietnames
... of class of words denoting parts of human body in English and VietNamese on semantic transference 2.1 The origin of names referring to parts of the human body According to the aspect of origin, ... features - The amount of meanings In English, there are 82 words having primary meaning referring to parts of the human body possess...
Ngày tải lên: 18/12/2013, 21:45
Tài liệu Project (written version):“The problems of the “Citibus” (bus operating company) and their possible solutions. Drawing a contract.” doc
... or any other laws of Ukraine and to make this document has a legal effect) On the next stage both parties sign the contract and we think that the drivers are enough motivated, they fulfil the ... make a contract whick will determine the rights and obligations of both parties: the administration of the “Citibus operating company and its drivers and which will...
Ngày tải lên: 20/12/2013, 19:15
Tài liệu Báo cáo khoa học: The Arabidopsis protein kinase Pto-interacting 1-4 is a common target of the oxidative signal-inducible 1 and mitogen-activated protein kinases docx
... GCTCAGTGGTGGA-3 and 5-CTGAGGGAAGCAAG AATGGA-3, OXI1 (At3g25250): 5-GACGAGATTATC AGATTTTACGC-3 and 5-AACTGGTGAAGCGGAAG AGAC-3, PTI1-4 (At2g47060): 5-CCCCAAAGAAAATG AGTTGCT-3 and 5-GCATCATTTCCTGGAGGAAAG-3 ... Journal 278 (2 011 ) 11 26 11 36 ª 2 011 The Authors Journal compilation ª 2 011 FEBS 11 31 PTI1-4, a common target of OXI1 and MAPKs C Forzani et al AGC2-3) were also...
Ngày tải lên: 14/02/2014, 19:20
Tài liệu A Review of the Ocean Research Priorities Plan and Implementation Strategy docx
... president of the National Academy of Sciences The National Academy of Engineering was established in 1964, under the charter of the National Academy of Sciences, as a parallel organization of outstanding ... six thematic areas for clarity and appropriateness of thematic research priorities (Task 3a) ; balance among substantive research areas as well as among r...
Ngày tải lên: 17/02/2014, 06:20
Tài liệu Báo cáo khoa học: Receptor binding characteristics of the endocrine disruptor bisphenol A for the human nuclear estrogen-related receptor c pptx
... Ala eliminated activity in binding to a BPA molecule, and individual mutations drastically reduced the activity Because Ala lacks the characteristic side chains of Glu and Arg, the mutant receptors ... A in human ERRc TGGTGGTTA-3¢ (xxx ¼ gcg for Glu275Ala, cgg for Glu275Arg, gac for Glu275Asp, and ctg for Glu275Leu); 5¢-TCCTTGGTGTCGTATACxxxTCTCTTTCA-3¢ (xxx ¼ gcg for...
Ngày tải lên: 18/02/2014, 16:20
Tài liệu Báo cáo khoa học: Structural and functional investigations of Ureaplasma parvum UMP kinase – a potential antibacterial drug target ppt
... UMPK The F133N mutation was created using UMP kinase from Ureaplasma parvum the following primers: F133N-fw (5¢-GATTTTTGTGGCT GGAACAGGAAACCCATATTTTACAACTGATTCG) and F133N-rv (5¢-CGAATCAGTTGTAAAATATGGGT ... with ADP and UDP, and ADP showed a rate that was > 20 times that of UDP In order to determine the true Km for UMP and ATP, a two-substrate assay was performed at fou...
Ngày tải lên: 18/02/2014, 16:20
Tài liệu Báo cáo khoa học: Functional studies of active-site mutants from Drosophila melanogaster deoxyribonucleoside kinase Investigations of the putative catalytic glutamate–arginine pair and of residues responsible for substrate specificity docx
... catalytic residues: E52 and R105 It is evident from the kinetic results that mutation of E52 changes only the catalytic rate For the E52D mutant the Km value was approximately the same as for the wild-type ... mutation of deoxyribonucleoside kinase L Egeblad-Welin et al Human deoxyribonucleoside kinases are targets for the chemotherapeutic treatment of...
Ngày tải lên: 19/02/2014, 02:20
A Review of the EPA Water Security Research and Technical Support Action Plan ppt
... in the Action Plan and evaluates their prioritization and timing A Review of the EPA Water Security Action Plan OVERARCHING ISSUES The Action Plan contains an extensive list of drinking water and ... how the EPA 20 A Review of the EPA Water Security Action Plan will create and manage databases that are accessible to all the wa...
Ngày tải lên: 06/03/2014, 15:20
Báo cáo khoa học: Interactions of HIPPI, a molecular partner of Huntingtin interacting protein HIP1, with the specific motif present at the putative promoter sequence of the caspase-1, caspase-8 and caspase-10 genes pdf
... Allowing two substitutions Allowing two substitutions Allowing one substitution AAAGACATG AAAGACAGG AAAGAGATT AAAGAGATG AAAGACATA AAAGACATA AAAGAGAAC AAAGACATA AAAGAAAAG AAACAGATG AAAGAAAAG AAAGAAAAG ... EMSA Result Average Kd (nM) AAAGACATG AGAGACATG AAGGACATG AAATACATG AAAGCCATG AAAGAGATG AAAGACCTG AAAGACACG AAAGACATA + ND ND – – + ND ND ND + – – – – + – + – 0.25 1.5 p=0.01 60_HI 60M_HI Fig...
Ngày tải lên: 07/03/2014, 10:20
Báo cáo khoa học: Binding of the volatile general anesthetics halothane and isoflurane to a mammalian b-barrel protein doc
... Johansson et al on global protein dynamics, with the goal of further defining a potential mechanism of volatile general anesthetic action Results Binding of the volatile anesthetic halothane to the ... yields a Kd of 0.46 ± 0.10 mm and a Qmax of 0.17 ± 0.01 Binding of the volatile anesthetics halothane and isoflurane to the porcine odora...
Ngày tải lên: 07/03/2014, 16:20
How to attract interests and involvement of the 9th graders in a speaking lessons at Minh Thanh secondary in Quang Ninh
... study of how to attract interests and involvements of 9th graders in a speaking lesson at Minh Thanh secondary school in Quang Ninh Aims of the study The study is carried out to research: Firstly, ... questionnaire 28 CHAPTER 2: STUDY ON HOW A SPEAKING LESSON IS TAUGHT IN MINH THANH SECONDARY SCHOOL IN QUANG NINH This chapter ai...
Ngày tải lên: 15/03/2014, 10:03