Differential global effects of selective estrogen receptor modulators on estrogen receptor binding and transcriptional regulation

Differential global effects of selective estrogen receptor modulators on estrogen receptor binding and transcriptional regulation

Differential global effects of selective estrogen receptor modulators on estrogen receptor binding and transcriptional regulation

... Imhof and McDonnell 1996) Transcriptional controls from histones Another significant transcriptional control is the discovery of histones and their functions to control the accessibility of chromatin ... as one of the factors for predicting and diagnosing breast cancer (Ali and Coombes 2000) Estrogen receptor belongs to the family of steroid receptor and is activat...

Ngày tải lên: 14/09/2015, 14:05

214 203 0
Tài liệu Báo cáo Y học: Differential effects of arachidonoyl trifluoromethyl ketone on arachidonic acid release and lipid mediator biosynthesis by human neutrophils pot

Tài liệu Báo cáo Y học: Differential effects of arachidonoyl trifluoromethyl ketone on arachidonic acid release and lipid mediator biosynthesis by human neutrophils pot

... studies by demonstrating that inhibition of LTB4 and PAF biosynthesis by AACOCF3 occurs without concomitant inhibition of AA release Generation of the common precursor pool by CoA-IT occurs by the ... activation is accompanied by an increase in PAF biosynthesis via acetylation of 1-alkyl-2-lyso-GPC by acetyl transferase (Fig 8, f) activity, competition for 1-alkyl-...

Ngày tải lên: 22/02/2014, 07:20

11 524 0
báo cáo hóa học:" Proliferating and differentiating effects of three different growth factors on pluripotent mesenchymal cells and osteoblast like cells" pdf

báo cáo hóa học:" Proliferating and differentiating effects of three different growth factors on pluripotent mesenchymal cells and osteoblast like cells" pdf

... The effects of growth factors on the production of osteopontin and osteocalcin Biomed Sci Instrum 2006, 42:31-36 Gonnerman KN, Brown LS, Chu TM: Effects of growth factors on cell migration and ... coating on osteoblast like cells and pluripotent mesenchymal cells is also in accordance with previous studies [8,25,26] The proliferating effect of the...

Ngày tải lên: 20/06/2014, 01:20

8 434 0
Báo cáo lâm nghiệp: " Effects of long-term water stress on net photosynthesis, growth and water-use efficiency of conifers in the field" doc

Báo cáo lâm nghiệp: " Effects of long-term water stress on net photosynthesis, growth and water-use efficiency of conifers in the field" doc

... (1987b) The influence of constant long-term water stress on 7-26 Larcher W (1960) Transpiration and photosynthesis of detached leaves and shoots of Quer cus pubescens and Q ilex during desiccation ... they take seasonal changes in daylength into marily consideration Thus, the reduction in net was photosynthesis was always greater on long and sunny summer days...

Ngày tải lên: 09/08/2014, 04:20

5 324 0
Báo cáo y học: "Discrepancy between the in vitro and in vivo effects of murine mesenchymal stem cells on T-cell proliferation and collagen-induced arthritis" doc

Báo cáo y học: "Discrepancy between the in vitro and in vivo effects of murine mesenchymal stem cells on T-cell proliferation and collagen-induced arthritis" doc

... and cellular responses; and analysis of T-cell proliferation LG contributed to CIA induction and evaluation and to analysis of T-cell proliferation PM contributed to the design of the study and ... inhibition of T-cell proliferation was demonstrated by the addition of inhibitors of these enzymes - GW274150 and indomethacin [8,36], respectively - to t...

Ngày tải lên: 12/08/2014, 11:23

11 464 0
Báo cáo y học: " mRNA expression profiles show differential regulatory effects of microRNAs between estrogen receptor-positive and estrogen receptor-negative breast cancer" pdf

Báo cáo y học: " mRNA expression profiles show differential regulatory effects of microRNAs between estrogen receptor-positive and estrogen receptor-negative breast cancer" pdf

... hsa-miR-769-5p RE-score profiles of microRNAs for the classification of ER+ and ER- breast tumors Figure RE-score profiles of microRNAs for the classification of ER+ and ER- breast tumors The figure ... significantly higher inhibitory activity in ER- cancer, strongly indicating that the differential regulatory effects of miRNAs can not be explained by miRNA ex...

Ngày tải lên: 09/08/2014, 20:20

17 259 0
báo cáo hóa học: " e differential mediating effects of pain and depression on the physical and mental dimension of quality of life in Hong Kong Chinese adults" pptx

báo cáo hóa học: " e differential mediating effects of pain and depression on the physical and mental dimension of quality of life in Hong Kong Chinese adults" pptx

... et al.: The differential mediating effects of pain and depression on the physical and mental dimension of quality of life in Hong Kong Chinese adults Health and Quality of Life Outcomes 2010 8:1 ... mediation is established if the association between depression and QoL is reduced to zero The Sobel test [24] determined whether pain...

Ngày tải lên: 18/06/2014, 19:20

6 521 0
Báo cáo hóa học: " Differential Gene Expression to Investigate the Effects of Low-level Electrochemical Currents on Bacillus subtilis" doc

Báo cáo hóa học: " Differential Gene Expression to Investigate the Effects of Low-level Electrochemical Currents on Bacillus subtilis" doc

... used as the model Gram-positive species to systematically investigate the effects of electrochemical currents on bacteria including the morphology, viability, and gene expression of planktonic cells, ... (henceforth ECs) To better understand the mechanism of bacterial control by ECs, we conducted a systematic study of the effects of weak ECs on the...

Ngày tải lên: 20/06/2014, 23:20

47 419 1
Báo cáo y học: "A comparative study of the inhibitory effects of interleukin-1 receptor antagonist following administration as a recombinant protein or by gene transfer." pps

Báo cáo y học: "A comparative study of the inhibitory effects of interleukin-1 receptor antagonist following administration as a recombinant protein or by gene transfer." pps

... increased optimism for the use of gene transfer in the treatment of chronic articular disease Indeed, IL-1Ra gene therapy has demonstrated impressive efficacy in animal models of RA and OA, and a ... the cellular level, the advantage of gene transfer as a means of drug delivery arises from the sustained availability of IL-1Ra that this method permits Material...

Ngày tải lên: 09/08/2014, 01:23

9 422 0
Báo cáo y học: "Differential direct effects of cyclo-oxygenase-1/2 inhibition on proteoglycan turnover of human osteoarthritic cartilage: an in vitro study" pptx

Báo cáo y học: "Differential direct effects of cyclo-oxygenase-1/2 inhibition on proteoglycan turnover of human osteoarthritic cartilage: an in vitro study" pptx

... be consistent in vitro and in vivo The direct negative effects of indomethacin are mainly reflected by an inhibition of proteoglycan synthesis and diminished retention of these newly formed proteoglycans ... proteoglycan turnover (Table 1): low proteoglycan synthesis, high proteoglycan release (both newly formed proteoglycans and resident proteoglycans) and dimin...

Ngày tải lên: 09/08/2014, 07:20

9 557 0
Báo cáo y học: "Differential effects of Radix Paeoniae Rubra (Chishao) on cytokine and" pptx

Báo cáo y học: "Differential effects of Radix Paeoniae Rubra (Chishao) on cytokine and" pptx

... The University of Hong Kong, Pokfulam, Hong Kong SAR, PR China Cytokine Biology Group, Department of Paediatrics and Adolescent Medicine, The University of Hong Kong, Pokfulam, Hong Kong SAR, PR ... 3Department of Pharmacology and Pharmacy, The University of Hong Kong, Pokfulam, Hong Kong SAR, PR China 4Purapharm International Hong Kong, Central, Hong Kong SAR, PR China Authors’ c...

Ngày tải lên: 13/08/2014, 14:20

14 550 0
Báo cáo y học: "Role of selective V2-receptor-antagonism in septic shock: a randomized, controlled, experimental study" pot

Báo cáo y học: "Role of selective V2-receptor-antagonism in septic shock: a randomized, controlled, experimental study" pot

... significant differences among groups Laboratory variables of organ function and arginine vasopressin plasma levels Alanine aminotransferase and aspartate aminotransferase activity as well as plasma ... blood gas, laboratory, and histological analyses Hemodynamic measurements, arterial and mixed venous blood gas, and laboratory analyses of variables of organ dysfunction and AVP plasma le...

Ngày tải lên: 13/08/2014, 21:21

10 307 0
Phenology of tropical birds in peninsular malaysia effects of selective logging and food resources

Phenology of tropical birds in peninsular malaysia effects of selective logging and food resources

... determine whether there is correlation of breeding, molting and diet of birds belonging to different feeding guilds, with rainfall and food resources Information on diet changes during breeding and ... the food abundance (i.e arthropods, fruits and flowers), and the frequency of occurrence of breeding and molting in resident understory tropical rainforest bird...

Ngày tải lên: 28/11/2015, 13:44

77 184 0
Tài liệu Báo cáo khoa học: Structural effects of a dimer interface mutation on catalytic activity of triosephosphate isomerase The role of conserved residues and complementary mutations pptx

Tài liệu Báo cáo khoa học: Structural effects of a dimer interface mutation on catalytic activity of triosephosphate isomerase The role of conserved residues and complementary mutations pptx

... CACCATGGCTAGAAAATATTTTGTCGCAGCAAACTTCAAATGTAA GAACCTTTATTCGCTATTGGTACCGGTAAA GAACCTTTATTCGCTATTGGTACCGGTAAA TCACCGGTCCATGATCCATT NcoI KpnI KpnI HaeIII 4178 FEBS Journal 276 (2009) 41694183 ê 2009 The Authors ... maintain the unusual Ramachandran angles for the K12 residue, and a Ramachandran scatter plot for the K12 residues in 21 TIM structures from various sources (available f...

Ngày tải lên: 18/02/2014, 11:20

15 635 0
Tài liệu Báo cáo khoa học: Inhibitory effects of nontoxic protein volvatoxin A1 on pore-forming cardiotoxic protein volvatoxin A2 by interaction with amphipathic a-helix doc

Tài liệu Báo cáo khoa học: Inhibitory effects of nontoxic protein volvatoxin A1 on pore-forming cardiotoxic protein volvatoxin A2 by interaction with amphipathic a-helix doc

... membrane Interactions between VVA1 and VVA2 B Fig Effects of volvatoxin A1 (VVA1) on the hemolytic and cytotoxic activity of volvatoxin A2 (VVA2) (A) The hemolytic activity of VVA2 regulated by VVA1 ... VVA2 can use VVA1 as a basis for the formation of VVA2 oligomers Interaction of VVA1 and VVA2 by amphipathic a-helix To identify the binding sites in VVA1 respo...

Ngày tải lên: 19/02/2014, 06:20

12 585 0
w