Molecular interactions of tectonin proteins in host and pathogen recognition

Molecular interactions of tectonin proteins in host and pathogen recognition

Molecular interactions of tectonin proteins in host and pathogen recognition

... analysis of GBP and hTectonin peptides 121 4.13 Peptides derived from the Tectonin domains of GBP and hTectonin bind LA with high affinity 123 4.14 Peptides derived from the Tectonin domains of GBP and ... docking of the GBP-CRP interaction 93 3.40 Binding affinity of infected GBP 94 3.41 Effect of infection upon GBP-CRP interaction with LA 95 3.42 Effect of calcium on...

Ngày tải lên: 14/09/2015, 08:38

194 213 0
Báo cáo sinh học: "Adaptive evolution of centromere proteins in plants and animals" ppt

Báo cáo sinh học: "Adaptive evolution of centromere proteins in plants and animals" ppt

... Comparisons of CENP-C proteins in animals, yeast and plants The CENPC motif and conserved regions found at the termini of CENP-C proteins are indicated For pairwise comparisons of protein-coding sequences, ... DNAbinding proteins would maintain an interface with the conserved kinetochore machinery Indeed, regions of CENP-C that show evidence of positive selection inclu...

Ngày tải lên: 06/08/2014, 18:21

17 385 0
Báo cáo khoa học: Molecular characterization of secretory proteins Rv3619c and Rv3620c fromMycobacterium tuberculosisH37Rv docx

Báo cáo khoa học: Molecular characterization of secretory proteins Rv3619c and Rv3620c fromMycobacterium tuberculosisH37Rv docx

... heat of dilution was subtracted from the raw data of titration of Rv3619c with Rv3620c (B) Far-UV CD spectra of Rv3619c, Rv3620c, and the : complex CD spectra of lM Rv3619c (j), Rv3620c (•) and ... aliquots of Rv3619c to Rv3620c The sample cell was filled with 1.43 mL of 0.01 mm Rv3620c and titrated against 0.1 mm Rv3619c Thirty injections of 10 lL each...

Ngày tải lên: 22/03/2014, 16:21

13 280 0
báo cáo hóa học:" Assessing the clinical utility of measuring Insulin-like Growth Factor Binding Proteins in tissues and sera of melanoma patients" potx

báo cáo hóa học:" Assessing the clinical utility of measuring Insulin-like Growth Factor Binding Proteins in tissues and sera of melanoma patients" potx

... (IGF1R): Insulin-like Growth Factor- 1 receptor; (IGFBP-3): Insulin-like Growth Factor Binding Protein-3; (IGFBP-4): Insulin-like Growth Factor Binding; Protein-4; (MAPK): Mitogen-activated protein kinase; ... role of secreting IGFBPs in melanoma However, data not support the clinical utility of measuring levels of IGFBP-3 and -4 in sera of melan...

Ngày tải lên: 18/06/2014, 15:20

9 486 0
báo cáo hóa học:" Molecular Etiology of Hearing Impairment in Inner Mongolia: mutations in SLC26A4 gene and relevant phenotype analysis" ppt

báo cáo hóa học:" Molecular Etiology of Hearing Impairment in Inner Mongolia: mutations in SLC26A4 gene and relevant phenotype analysis" ppt

... hearing impairment patients and provide effective genetic testing and accurate counseling for hearing loss patients and families in China, we performed SLC26A4 sequence analysis in hearing impairment ... http://www.translational-medicine.com/content/6/1/74 Table 1: Phenotype and genotype of SLC26A4 gene related hearing impairment in Inner mongilia (Cont...

Ngày tải lên: 18/06/2014, 15:20

12 549 0
Báo cáo sinh học: " Molecular biodiversity of cassava begomoviruses in Tanzania: evolution of cassava geminiviruses in Africa and evidence for East Africa being a center of diversity of cassava geminiviruses" pptx

Báo cáo sinh học: " Molecular biodiversity of cassava begomoviruses in Tanzania: evolution of cassava geminiviruses in Africa and evidence for East Africa being a center of diversity of cassava geminiviruses" pptx

... TACATCGGCCTTTGAGTCGC ATGG CTTATTAACGCCTATATAAAC ACC KSGGGTCGACGTCATCAATGA CGTTRTAC AARGAATTCATKGGGGCCCA RARRGACTGGC GTGACGAAGATTGCATTCT AATAGTATTGTCATAGAAG TAAGAAGATGGTGGGAATCC CGATCAGTATTGTTCTGGAAC TGGTGGGAATCCCACCTT ... (EACMV), East African cassava mosaic Cameroon virus (EACMCV), East African cassava mosaic Malawi virus (EACMMV), East African cassava mosaic Zanzibar virus (EACM...

Ngày tải lên: 18/06/2014, 22:20

23 612 0
báo cáo hóa học:" Molecular biodiversity of cassava begomoviruses in Tanzania: evolution of cassava geminiviruses in Africa and evidence for East Africa being a center of diversity of cassava geminiviruses" pot

báo cáo hóa học:" Molecular biodiversity of cassava begomoviruses in Tanzania: evolution of cassava geminiviruses in Africa and evidence for East Africa being a center of diversity of cassava geminiviruses" pot

... TACATCGGCCTTTGAGTCGC ATGG CTTATTAACGCCTATATAAAC ACC KSGGGTCGACGTCATCAATGA CGTTRTAC AARGAATTCATKGGGGCCCA RARRGACTGGC GTGACGAAGATTGCATTCT AATAGTATTGTCATAGAAG TAAGAAGATGGTGGGAATCC CGATCAGTATTGTTCTGGAAC TGGTGGGAATCCCACCTT ... (EACMV), East African cassava mosaic Cameroon virus (EACMCV), East African cassava mosaic Malawi virus (EACMMV), East African cassava mosaic Zanzibar virus (EACM...

Ngày tải lên: 20/06/2014, 04:20

23 522 0
Báo cáo khoa học: "Molecular analysis of hprt mutation in B6C3F1 mice exposed to ozone alone and combined treatment of 4-(N-methyl-N-nitrosamino)-1-(3-pyridyl)-1-butanone and/or dibutyl phthalate for 32 and 52 weeks" ppsx

Báo cáo khoa học: "Molecular analysis of hprt mutation in B6C3F1 mice exposed to ozone alone and combined treatment of 4-(N-methyl-N-nitrosamino)-1-(3-pyridyl)-1-butanone and/or dibutyl phthalate for 32 and 52 weeks" ppsx

... hypoxanthineguanine phosphoribosyltransferase (hprt) locus of lymphocytes isolated from spleens of mice following exposure to ozone, NNK, and DBP, and combined treatments of NNK and DBP on ozone for 32- ... Molecular analysis of hprt mutation 383 Table DNA sequence analysis of hprt mutant in splenic cells of B6C3F1 male mice in 52- wk study Typ...

Ngày tải lên: 07/08/2014, 18:20

7 397 0
Báo cáo khoa hoc:" Genetic polymorphism of milk proteins in African Bos taurus and Bos indicus populations" pdf

Báo cáo khoa hoc:" Genetic polymorphism of milk proteins in African Bos taurus and Bos indicus populations" pdf

... existence of at least another allele of -casein sl a was suggested © Inra/Elsevier, Paris , A2 /3-Cn genetic polymorphism / milk proteins / Africa / Bos taurus / Bos indicus Résumé - Polymorphisme ... lactoprotein polymorphisms in Bos indicus, namely the predominance, at the a locus, of the C -casein sl allele, contrasting with the usual higher frequency of t...

Ngày tải lên: 09/08/2014, 18:21

15 410 0
Signal sequence analysis of expressed sequence tags from the nematode Nippostrongylus brasiliensis and the evolution of secreted proteins in parasites potx

Signal sequence analysis of expressed sequence tags from the nematode Nippostrongylus brasiliensis and the evolution of secreted proteins in parasites potx

... [53] The closest free-living taxa to the Strongylida are members of the Rhabditina, including C elegans, and both are grouped in Clade V of the Nematoda, on the basis of small subunit rRNA sequence ... existing entries), using a cutoff score of 80 in BLASTX (P < e-10) The number of ESTs bearing potential signal sequences was then calculated and the results...

Ngày tải lên: 09/08/2014, 20:20

15 416 0
báo cáo khoa học: "Structure and expression of the maize (Zea mays L.) SUN-domain protein gene family: evidence for the existence of two divergent classes of SUN proteins in plants" pot

báo cáo khoa học: "Structure and expression of the maize (Zea mays L.) SUN-domain protein gene family: evidence for the existence of two divergent classes of SUN proteins in plants" pot

... ARTICLE Open Access Structure and expression of the maize (Zea mays L.) SUN- domain protein gene family: evidence for the existence of two divergent classes of SUN proteins in plants Shaun P Murphy1, ... previously unknown class of SUN- related proteins in plants mRNA Expression Profiling of ZmSUN Protein Genes The conservation...

Ngày tải lên: 11/08/2014, 11:21

22 451 0
Báo cáo y học: "Profiling of cellular proteins in porcine reproductive and respiratory syndrome virus virions by proteomics analysis" pps

Báo cáo y học: "Profiling of cellular proteins in porcine reproductive and respiratory syndrome virus virions by proteomics analysis" pps

... cytoskeleton system proteins, which have the maximum profusion among the identified cellular proteins, including Actin, Keratin, Annexin, Coronin, Tubulin, Tropomyosin, and Cofilin Enveloped viruses ... Profiling of cellular proteins in porcine reproductive and respiratory syndrome virus virions by proteomics analysis Virology Journal 2010 7:242 Submit your nex...

Ngày tải lên: 12/08/2014, 01:22

12 429 0
Báo cáo y học: " The effect of interleukin-13 (IL-13) and interferon-g (IFN-g) on expression of surfactant proteins in adult human alveolar type II cells in vitro" docx

Báo cáo y học: " The effect of interleukin-13 (IL-13) and interferon-g (IFN-g) on expression of surfactant proteins in adult human alveolar type II cells in vitro" docx

... study is to investigate the IL-13 and IFN-g effect on the expression of the surfactant proteins using primary human adult ATII cells in monolayer culture in vitro The experiments with human ATII ... effect of IL-13 or IFN-g on the expression of surfactant proteins in primary adult human ATII cells has not been reported Methods for isol...

Ngày tải lên: 12/08/2014, 11:23

13 257 0
w