Distributed data reconciliation and bias estimation with non

Distributed data reconciliation and bias estimation with non gaussian noise for sensor network

... y2 and y3 78 Table 5.1: Bias estimation results for data without outliers 99 Table 5.2: Bias estimation results for data with 25% outliers times larger than original data 99 Table 5.3: Bias estimation ... CHAPTER DISTRIBUTED BIAS ESTIMATION (DBE) 61 4.1 INTRODUCTION 61 4.2 BIAS ESTIMATION 63 4.2.1 Least squares (LS) bias estimation 64 4.2.2 GT-based...

Ngày tải lên : 14/09/2015, 08:38

126
235
0

Framework for joint data reconciliation and parameter estimation

... estimator for a joint data reconciliation – parameter estimation strategy is formulated The algorithm consists of three main steps: the preliminary estimation and the estimation of the GT parameters ... steps corresponding to data reconciliation and parameter estimation are merged into a single joint data reconciliation – parameter estimation (DRPE) step...

Ngày tải lên : 06/10/2015, 21:15

104
212
0

Design and analysis of object replacement policies on dynamic data allocation and replication algorithm with buffer constraints

... of data allocation and replication, a data allocation and replication algorithm solves three fundamental questions: Which object should be replicated? How Chapter Introduction many replicas of ... Chapter Data Allocation and Replication with Finite-size Buﬀer Constraints 35 Thus, an extra cost of control-message is needed to inform the CCU of the change...

Ngày tải lên : 04/10/2015, 10:24

104
316
0

Báo cáo khoa học: "Combining Lexical, Syntactic, and Semantic Features with Maximum Entropy Models for Extracting Relations" pptx

... 2 Maximum Entropy models for extracting relations We built Maximum Entropy models for predicting the type of relation (if any) between every pair of mentions within each sentence ... ﬁnal ranking and the results of other participants Discussion We have presented a statistical approach for extracting relations where we combine diverse lexical, syntactic, and sema...

Ngày tải lên : 31/03/2014, 03:20

4
293
0

Báo cáo y học: "Genome-wide analysis of primary CD4+ and CD8+ T cell transcriptomes shows evidence for a network of enriched pathways associated with HIV disease" pot

... member KLRD1L gtgggagaatggctctgc KLRD1R tttgtattaaaagtttcaaatgatgga BDLvsLTNP CD8 2.5 2.1 IRS2 NM_003749.2 insulin receptor substrate IRS2L tgacttcttgtcccaccactt IRS2R catcctggtgataaagccaga CD8 3.8 ... ACTA2L ctgttccagccatccttcat ACTA2R tcatgatgctgttgtaggtggt BDLvsVIR CD8 -1.3 -2.2 ATP6V1D NM_015994.2 ATPase, H+ transporting, lysosomal 34kDa, V1 subunit D ATP6V1DL ttttcactagctgaagccaagtt ATP6...

Ngày tải lên : 13/08/2014, 01:20

21
376
0

Báo cáo y học: "Morning and evening behavior in children and adolescents treated with atomoxetine once daily for Attention-Deficit/Hyperactivity Disorder (ADHD): Findings from two 24-week, open-label studie" potx

... well-being in children and adolescents treated with atomoxetine for attention-deficit/hyperactivity disorder: Findings from a patient, parent and physician perspective Child Adolesc Psychiatry Mental ... Difficulty playing quietly in the afternoon /evening Inattentive and distractable in the afternoon /evening Difficulty transitioning Arguing or struggling in...

Ngày tải lên : 13/08/2014, 18:21

10
475
0

Local domain free discretization method and its combination with immersed boundary method for simulation of fluid flows

... LOCAL DOMAIN- FREE DISCRETIZATION METHOD AND ITS COMBINATION WITH IMMERSED BOUNDARY METHOD FOR SIMULATION OF FLUID FLOWS WU YANLING (B.Eng,NUAA, M.Eng, NUS) A THESIS SUBMITTED FOR THE DEGREE OF ... LDFD method to flexibly handle flow problems with complex geometry LDFD-IBM is a delicate combination of LDFD method and Immersed Boundary Meth...

Ngày tải lên : 09/09/2015, 10:08

250
567
0

On multi zone tracking and non gaussian noise filtering for model predictive control

... gains for zone and zone outputs are 100 times smaller than the gains for zone output This shows that for SMPC the outputs of zone and zone contribute little to the zone control signal, only the ... submitted for any degree in any university previously WANG XIAOQIONG 30 Mar 2014 ON MULTIZONE TRACKING AND NON- GAUSSIAN NOISE FILTERING FOR THE MODEL PR...

Ngày tải lên : 09/09/2015, 11:24

154
423
0

Electrospun titanium dioxide nanostructures and their composites with carbon rich materials for energy conversion and storage

... ELECTROSPUN TITANIUM DIOXIDE NANOSTRUCTURES AND THEIR COMPOSITES WITH CARBON RICH MATERIALS FOR ENERGY CONVERSION AND STORAGE ZHU PEINING (B Eng., Huazhong University of Science and Technology) ... electrical devices Therefore, the topic of renewable energy comes with the dual topic of energy conversion and storage There are mainly two kinds of ba...

Ngày tải lên : 10/09/2015, 09:12

229
280
0

Báo cáo hóa học: " Research Article Reiterative Robust Adaptive Thresholding for Nonhomogeneity Detection in Non-Gaussian Noise" pot

... τi xi , √ H1 : zi = pi + τi xi (6) Bearing in mind that we are concerned with training data containing interfering targets, which share the same steering vector as that of the desired target, ... situation of multiple outliers in the secondary data is depicted in Figure 13, in addition to the interfering target in Pc , another interfering one with the same INR A Younsi et al 1.2 0.9...

Ngày tải lên : 21/06/2014, 22:20

11
439
0

Báo cáo hóa học: " Dynamic Agent Classiﬁcation and Tracking Using an Ad Hoc Mobile Acoustic Sensor Network" ppt

... and N R Sandell Jr, “Detection with distributed sensors,” IEEE Trans on Aerospace and Electronics Systems, vol 17, pp 501–510, July 1981 [3] R Brooks, C Griﬃn, and D S Friedlander, “Self-organized ... networks can coordinate platforms around tracks and provide relevant processing with a minimum of bandwidth and power consumption related to interplatform communications This procedure...

Ngày tải lên : 23/06/2014, 01:20

7
192
0

Interference minimized multipath routing with congestion control in wireless sensor network for multimedia streaming

... not hold true for wireless networks due to route coupling 3.3 Wireless Network Multipath load balancing in a single-channel wireless network is not as straightforward as in a wired network This ... WSN with high-capacity UAV backbone network support for multimedia streaming, however multipath routing is not used Much research has been done on multipath 17 r...

Ngày tải lên : 08/11/2015, 16:39

101
252
0

Báo cáo khoa học: "Hierarchical Joint Learning: Improving Joint Parsing and Named Entity Recognition with Non-Jointly Labeled Data" potx

... likelihood and partial derivatives See (Finkel et al., 2008) for details 4.3 Joint Model of Parsing and Named Entity Recognition Our base joint model for parsing and named entity recognition ... hierarchical joint model to parsing and named entity recognition, and it reduced errors by over 20% on both tasks when compared to a joint model trained on onl...

Ngày tải lên : 30/03/2014, 21:20

9
336
0

Báo cáo hóa học: " Research Article Distributed Space-Time Block Coded Transmission with Imperfect Channel Estimation: Achievable Rate and Power Allocation" pot

... constrained to P, and it is assumed that the transmitters cooperate to provide a distributed spacetime block encoder, and that the channel coeﬃcients remain constant during the transmission of a space-time ... D-STBCs, SIMO subchannels, and distributed MIMO channel with two receive antennas, versus the channel estimation error variance of the ﬁrst subchannel, that is,...

Ngày tải lên : 22/06/2014, 19:20

9
257
0