Regulation of mitotic spindle biogenesis in budding yeast 2

Regulation of mitotic spindle biogenesis in budding yeast

Regulation of mitotic spindle biogenesis in budding yeast

... the formation of a bipolar mitotic spindle Hence, understanding the regulation of mitotic spindle biogenesis, the subject of this dissertation, is crucial for gaining insights into the chromosome ... Chapter1 Introduction All spindles are bipolar, but the structure of the spindle pole differs in different organisms The spindle pole is pivotal to the biogenesis of...

Ngày tải lên: 13/09/2015, 21:30

176 297 0
Báo cáo y học: " High-resolution transcription atlas of the mitotic cell cycle in budding yeast" pptx

Báo cáo y học: " High-resolution transcription atlas of the mitotic cell cycle in budding yeast" pptx

... transcript is mainly contained within the protein-coding message; of these cycle inphase, and display opposite-phase expression For of 24 SAPs in which only the antisense transcript cycles, the antisense ... collected every minutes for 200 minutes (equal to three cell cycles) The degree of synchrony was monitored by assessing the number of budding cells Nuclear posit...

Ngày tải lên: 09/08/2014, 20:21

11 489 0
Regulation of spindle behaviour by DNA replication and damage checkpoints in budding yeast

Regulation of spindle behaviour by DNA replication and damage checkpoints in budding yeast

... Phase and G2/M Checkpoints: In the budding yeast, DNA damage surveillance mechanisms operate in G1, S and G2 phases These are the G1 DNA damage checkpoint, the S phase replication and DNA damage checkpoints, ... REGULATION OF SPINDLE BEHAVIOR BY DNA REPLICATION AND DAMAGE CHECKPOINTS IN BUDDING YEAST SAURABH RAJENDRA NIRANTAR (B.Tech.(Hons)...

Ngày tải lên: 14/09/2015, 14:03

247 274 0
Báo cáo khoa học: Analysis of Lsm1p and Lsm8p domains in the cellular localization of Lsm complexes in budding yeast ppt

Báo cáo khoa học: Analysis of Lsm1p and Lsm8p domains in the cellular localization of Lsm complexes in budding yeast ppt

... analysis of Lsm1 p showing the importance of residues proposed to be involved in RNA binding and complex formation, and of the C-terminal region for the func- Lsm1 and -8 domains involved in localization ... N- and ⁄ or C-terminal domains, exchanged the central Sm domains or, in the case of Lsm8 p, made point mutations in putative RNA-binding r...

Ngày tải lên: 07/03/2014, 02:20

16 515 0
Báo cáo y học: "A genome wide analysis of the response to uncapped telomeres in budding yeast reveals a novel role for the NAD+ biosynthetic gene BNA2 in chromosome end protection" doc

Báo cáo y học: "A genome wide analysis of the response to uncapped telomeres in budding yeast reveals a novel role for the NAD+ biosynthetic gene BNA2 in chromosome end protection" doc

... measurements Table Primers for Q RT-PCR Primer Alias Sequence 1082 ACT1F GCCTTCTACGTTTCCATCCA 1083 ACT1R GGCCAAATCGATTCTCAAAA 1367 PAC2F AATAACGAATTGAGCTATGACACCAA 1368 PAC2R AGCTTACTCATATCGATTTCATACGACTT ... of BNA2, intracellular NAD+ levels may be maintained by the NAD+ salvage pathway Further experiments are required to determine the mechanism by which BNA2 affects telome...

Ngày tải lên: 14/08/2014, 21:20

17 432 0
Mechanism of protein quality control in the cytosol in budding yeast

Mechanism of protein quality control in the cytosol in budding yeast

... conserved cytosolic quality control pathways remains to be discovered The objective of this thesis is to get a better understanding of protein quality control in cytosol and further understand the mechanism ... al., 1998) The binding induces several factors; one of them being ubiquitin expression indicating its role in the regulation of the degradation syst...

Ngày tải lên: 10/09/2015, 15:54

165 378 0
Tài liệu Báo cáo Y học: Presence and regulation of the endocannabinoid system in human dendritic cells potx

Tài liệu Báo cáo Y học: Presence and regulation of the endocannabinoid system in human dendritic cells potx

... endocannabinoid system, we investigated the presence and regulation of endocannabinoids, cannabinoid receptors and FAAH in immature and mature dendritic cells obtained by stimulation with either the ... min), two fractions were obtained: a top leukocyte band containing mononuclear cells (monocytes and lymphocytes) and a lower band containing polymorphonuclear le...

Ngày tải lên: 22/02/2014, 07:20

8 646 0
Báo cáo khoa học: Protein transport in organelles: The composition, function and regulation of the Tic complex in chloroplast protein import pptx

Báo cáo khoa học: Protein transport in organelles: The composition, function and regulation of the Tic complex in chloroplast protein import pptx

... in protein protein interaction are blue and the dehydrogenase domains of Tic3 2 and Tic6 2 are shown in green Tic1 10 contains two transmembrane domains at the proximal N-terminus The topology of ... surprising to find proteins with redox-active domains as Tic constituents Up to now, the ‘regulon’ of the Tic complex comprises three proteins: Tic6 2, Tic3 2...

Ngày tải lên: 07/03/2014, 03:20

11 491 0
Báo cáo Y học: Regulation of a1,3galactosyltransferase expression in pig endothelial cells Implications for xenotransplantation doc

Báo cáo Y học: Regulation of a1,3galactosyltransferase expression in pig endothelial cells Implications for xenotransplantation doc

... Primers (Table 1) for pig glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (p7 and p8), E-selectin (p9 and Ó FEBS 2002 Regulation of a1,3GalT expression in pig endothelial cells (Eur J Biochem ... transfected into cultured cells In view of the relatively low efficiency of transfection of primary endothelial cells, these experiments were performed using the establ...

Ngày tải lên: 08/03/2014, 16:20

10 444 0
Báo cáo khoa học: Regulation of matrix metalloproteinase activity in health and disease pdf

Báo cáo khoa học: Regulation of matrix metalloproteinase activity in health and disease pdf

... hemopexin-like domain (C domain) of human gelatinase A (matrix metalloproteinase- 2) requires Ca2+ for fibronectin and heparin binding Binding properties of recombinant gelatinase A C domain to ... autocatalytic step of the activation by binding to the 64 kDa intermediate form of MMP-2 [52] Binding and activation of MMP-2 was abrogated in the presence of avb3 integrin-bindi...

Ngày tải lên: 15/03/2014, 00:20

18 464 0
Báo cáo Y học: Rum1, an inhibitor of cyclin-dependent kinase in fission yeast, is negatively regulated by mitogen-activated protein kinase-mediated phosphorylation at Ser and Thr residues pptx

Báo cáo Y học: Rum1, an inhibitor of cyclin-dependent kinase in fission yeast, is negatively regulated by mitogen-activated protein kinase-mediated phosphorylation at Ser and Thr residues pptx

... function of p25rum1 in the cell cycle may be regulated mainly by ubiquitination-based control of protein levels initiated by Cdc2–Cig1-mediated Thr5 8 /Thr6 2 phosphorylation However, Thr1 3 /Ser1 9 phosphorylation ... domain of the protein while the N-terminal portion is a regulatory domain mediating a reduction in activity upon phosphorylation of Thr1 3 /Ser...

Ngày tải lên: 17/03/2014, 23:20

11 520 0
Báo cáo Y học: Regulation of peptide-chain elongation in mammalian cells pptx

Báo cáo Y học: Regulation of peptide-chain elongation in mammalian cells pptx

... ADP-ribosylated by diphtheria toxin [25] ADP-ribosylation inhibits the activity of eEF2 Phosphorylation of eEF2 inhibits its activity, in translocation and in poly(U)-directed polyphenylalanine synthesis ... existence of multiple forms of eEF2 kinase in phaeochromocytoma cells and the regulatory properties of eEF2 kinase in ventricular cardiomyocytes suggest the existence...

Ngày tải lên: 23/03/2014, 21:20

9 469 0
Report on the Regulation of Reproductive Cell Donation in the European Union potx

Report on the Regulation of Reproductive Cell Donation in the European Union potx

... out the findings on the principles of confidentiality, anonymity and non-remuneration in the donation of reproductive cells, as well as donor compensation, consent for egg cell donations and the ... donor offers the cells exclusively for the use of the recipient specified in the declaration of donation; c) the declaration of donation includes – beyon...

Ngày tải lên: 28/03/2014, 16:20

21 302 0
Báo cáo khoa học: The C-terminal region of the proprotein convertase 1⁄ 3 (PC1⁄ 3) exerts a bimodal regulation of the enzyme activity in vitro pdf

Báo cáo khoa học: The C-terminal region of the proprotein convertase 1⁄ 3 (PC1⁄ 3) exerts a bimodal regulation of the enzyme activity in vitro pdf

... expressing the recombinant mPC1 ⁄ 3, the presence of the 87 kDa form in excess of the 66 ⁄ 71 kDa facilitates isolation of the enzyme and helps in maintaining the enzymatic activity at a proper ... Bernard N, Kitabgi P & Rovere-Jovene C (20 03) The Arg617–Arg618 cleavage site in the C-terminal domain of PC1 plays a major role in the processing and...

Ngày tải lên: 30/03/2014, 08:20

10 305 0
Từ khóa:
w