0
  1. Trang chủ >
  2. Giáo Dục - Đào Tạo >
  3. Cao đẳng - Đại học >

A novel meshfree smoothed least squares(SLS) method with applications to dielectrophoresis simulations

A novel meshfree smoothed least squares(SLS) method with applications to dielectrophoresis simulations

A novel meshfree smoothed least squares(SLS) method with applications to dielectrophoresis simulations

... FEM makes it possible to construct general purpose software, many commercial software packages are made available nowadays e.g ABAQUS, ANSYS, etc The FEM has a solid mathematical basis due to the ... good accuracy has been demonstrated viii Nomenclature Nomenclature a Coefficient vector A Linear differential operator B Boundary algebraic operator dc Characteristic length (average nodal spacing) ... techniques are required to restore the accuracy of the derivatives 3) Difficulty in adaptive analysis Adaptive analysis is an important step in numerical analysis to improve the accuracy of the...
  • 235
  • 351
  • 0
Báo cáo y học:

Báo cáo y học: "Evaluating the potential of a novel oral lesion exudate collection method coupled with mass spectrometry-based proteomics for oral cancer biomarker discovery" docx

... article as: Kooren et al.: Evaluating the potential of a novel oral lesion exudate collection method coupled with mass spectrometry-based proteomics for oral cancer biomarker discovery Clinical Proteomics ... DeSouza LV, Matta A, Tripathi SC, Ghanny S, DattaGupta S, Thakar A, Chauhan SS, Siu KWM: iTRAQMultidimensional Liquid Chromatography and Tandem Mass Spectrometry-Based Identification of Potential Biomarkers ... Collectively our results demonstrate the great potential of our exudate collection method for oral cancer biomarker discovery and clinical diagnostics Methods Patient information Exudates and brush...
  • 11
  • 350
  • 0
báo cáo hóa học:

báo cáo hóa học: " Human-robot cooperative movement training: Learning a novel sensory motor transformation during walking with robotic assistance-as-needed" doc

... conventional joystick and the TheraJoy device in both the horizontal and vertical configurations, each within multiple areas of the arm workspace Data and statistical analysis The data was analyzed across ... defined in Table 2: the Movement Speed metric These data have been analyzed with the special attention paid to validate hypotheses and Mean and standard deviation values are calculated and presented ... technologies with motivating rehabilitation strategies We created an upper arm stroke therapy suite consisting of several affordable hardware platforms and a novel and customizable universal software platform...
  • 17
  • 385
  • 0
báo cáo hóa học:

báo cáo hóa học: " Human-robot cooperative movement training: Learning a novel sensory motor transformation during walking with robotic assistance-as-needed" ppt

... motor adaptation can be used to derive an optimal strategy for robotic assistance, for the case of learning a novel sensory motor transformation during walking We acknowledge that this Page 12 ... Creating a Virtual Impairment and for Assisting in Motor Learning Experimental Apparatus for Creating a Virtual Impairment and for Assisting in Motor Learning Picture (left) and diagram (right) ... manual assistance provided by a physical trainer early in the rehabilitation process, followed by a gradual relaxation of that assistance as the patients regains movement ability Eventually, assistance...
  • 16
  • 238
  • 0
Báo cáo toán học:

Báo cáo toán học: "A graph-theoretic method for choosing a spanning set for a finite-dimensional vector space, with applications to the Grossman-Larson-Wright module and the Jacobian conjecture" pdf

... finite-dimensional vector space V from among a set of vectors X generated combinatorially, when it is not readily apparent how to order X or a canonical spanning set of V in a convenient way The motivation for ... which allows X to be a spanning set Is there a way to use a spanning set X ⊆ N (r, e) for Vm (r, e) to generate a spanning set Y ⊆ N (r + 1, e) for Vm′ (r + 1, e)? Are there other combinatorial ... 2, and S1 has a maximal number of vertices We emphasize that a tree can fall into a category in more than one way For example, the tree falls into Category I in three ways, and the tree falls...
  • 21
  • 299
  • 0
Báo cáo y học:

Báo cáo y học: "Screening of an endothelial cDNA library identifies the C-terminal region of Nedd5 as a novel autoantigen in systemic lupus erythematosus with psychiatric manifestations" ppt

... experiments and participated in analysis of data CA performed the statistical analysis and the clinical associations AS participated in the analysis and interpretation of data and in the revision of the ... Capoano R, Profumo E, Siracusano A, Salvati B, Rigano R, et al.: Screening of a HUAEC cDNA library identifies actin as a candidate autoantigen associated with carotid atherosclerosis Clin Exp Immunol ... Isenberg DA, Ward FJ, Smith TA, Panayiotou A, Staines NA, Murphy JJ: Identification of candidate endothelial cell autoantigens in systemic lupus erythematosus using a molecular cloning strategy: a role...
  • 8
  • 375
  • 0
A novel family of P-loop NTPases with an unusual phyletic distribution and transmembrane segments inserted within the NTPase domain pot

A novel family of P-loop NTPases with an unusual phyletic distribution and transmembrane segments inserted within the NTPase domain pot

... distantly related to the AAA+ and AP/NACHT NTPases [10,11,13] All eukaryotic and several bacterial members of the KAP family contain two or four transmembrane segments inserted into the P-loop NTPase ... [10] The ASCE division includes AAA+, ABC, PilT, superfamily 1/2 (SF1/2) helicases, and RecA/F1/F0 classes of ATPases, and a large assemblage of NTPases related to the AP(apoptotic) and NACHT families ... of the KAP family have a variable α-helical insert amino-terminal to the Walker B motif Remarkably, all animal KAP NTPases and three bacterial ones, those from Anabaena, G sulfurreducens and...
  • 10
  • 275
  • 0
Báo cáo y học:

Báo cáo y học: "Exome sequencing identifies a novel missense variant in RRM2B associated with autosomal recessive progressive external ophthalmoplegia" docx

... disease -associated variant using a 3730 × L DNA Analyser (Applied Biosystems, Foster City, CA, USA) The primers used were: forward, 5’-AGGCAGACAGGCTCTCAAAC-3’; reverse, 5’-GGCAGAATTAGATGCCATTG-3’ ... calling data on single nucleotide variants in this patient To enhance the accuracy of the variant calling used for this analysis, 1) only the data of single nucleotide variants were used and insertion/deletion ... 66:1028-1032 Tyynismaa H, Ylikallio E, Patel M, Molnar MJ, Haller RG, Suomalainen A: A heterozygous truncating mutation in RRM2B causes autosomaldominant progressive external ophthalmoplegia with multiple...
  • 7
  • 249
  • 0
báo cáo khoa học:

báo cáo khoa học: "Phase 1-2a multicenter dose-escalation study of ezatiostat hydrochloride liposomes for injection (Telintra®, TLK199), a novel glutathione analog prodrug in patients with myelodysplastic syndrome" doc

... phase 1- 2a study was the first clinical study of ezatiostat hydrochloride liposomes for injection in patients with all FAB classification types of MDS In phase 1, patients with MDS were administered ... for evaluation of ezatiostat in patients with MDS Pre-clinical data have shown that ezatiostat was well tolerated at single and repeated doses (up to 1920 mg/m2/ day and 3200 mg/m2/day) in rats ... Harmonization and Good Clinical Practice standards Institutional Review Board (IRB) approval was obtained from all participating institutions (Note: authors Azra Raza and Naomi Galili moved to St Vincent's...
  • 12
  • 276
  • 0
báo cáo khoa học:

báo cáo khoa học: "Nodulin 41, a novel late nodulin of common bean with peptidase activity" pot

... ataatatatatatatatatataataataataataataataataatatgatatatatgtatgtgtaaaataaagaa aagagaatgtataagcgtatggtttctttgcaagaagagcattactgagattggtatg 75 13 150 38 225 63 300 88 AEM05966.1) composed of a single ... cgttcatgcctaccacatgtcgttcacaaccatgcaccttactcctccctgaacaaaaaggatgtggaaaatcag T F M P T T C R S Q P C T L L L P E Q K G C G K S (P-2) S gtgaatgcatctacacatacaaatacggtgaccaatattcattcagcgaagggcttttgagtaccgaaaccctaa ... cactctcacccttctacaacccttccctcaccccatcacagcgcatcataaacgctgccctgcgctccatttctc P L S P F Y N P S L T P S Q R I I N A A L R S I S gactaaaccgagtttctaacctcctagatcaaaacaacaaactaccccaatcagttttgatcctacacaacggtg...
  • 14
  • 270
  • 0
A Router-aided P2P Trac Localization Method with Bandwidth Limitation

A Router-aided P2P Trac Localization Method with Bandwidth Limitation

... recognized as P2P traffic Recently, an accurate behavioral classification method for P2P traffic, named “Abacus, has been proposed [19] Abacus relies only on the count of packets and bytes that peers exchange ... approach to localize P2P traffic without any modification of existing application software We exploit an important feature of P2P applications that a querying peer will select a candidate peer as its neighbor ... computed according to Eqs (1) and (6) for the fixed-length bandwidth limitation scheme and the hierarchical bandwidth limitation scheme, respectively • Bandwidth limitation: for the bandwidth limitation, ...
  • 14
  • 170
  • 0
Development of a novel immersed boundary lattice boltzmann method and its applications

Development of a novel immersed boundary lattice boltzmann method and its applications

... Organization of The Thesis 23 Chapter Development of Efficient Lattice Boltzmann Method on Non-Uniform 25 Cartesian Mesh 2.1 Standard LBM 26 2.2 Taylor Series Expansion and Least Squares-base Lattice ... Non -Boundary Conforming Method 1.2.1 Sharp interface approach 1.2.2 Diffuse interface approach 1.2.2.1 Immersed boundary method 1.2.2.2 Force calculation in IBM 1.2.2.3 Advantages and disadvantages ... 1.2.2.3 Advantages and disadvantages of IBM The major advantage of IBM is its simplicity and easy implementation This is attributed to the decoupling of the solution of governing equation with the boundary...
  • 277
  • 412
  • 0
Báo cáo khoa học: A novel plant protein disulfide isomerase family homologous to animal P5 – molecular cloning and characterization as a functional protein for folding of soybean seed-storage proteins docx

Báo cáo khoa học: A novel plant protein disulfide isomerase family homologous to animal P5 – molecular cloning and characterization as a functional protein for folding of soybean seed-storage proteins docx

... TGTAAAG TGTAAAG + ) + )95 )1100 )1470 ACACacG ACACttG ACACaaG + + + + ) ) ) ) ) )140 )1100 )1596 )1632 )140 )1100 )1596 )1632 )1874 CAaaTG CAagTG CAaaTG CAaaTG CAaaTG CActTG CAttTG CAgtTG TGAGTCA ... The Authors Journal compilation ª 2007 FEBS 407 Soybean protein disulfide isomerase family H Wadahama et al plant tissues using an RNeasy Plant Mini kit Quantification of mRNA was performed by real-time ... peptide was constructed as follows The DNA fragment was amplified from GmPDIM cDNA by PCR using the primers 5¢-GACGACGACAAGATGC ACGCACTCTATGGAGC-3¢ and 5¢-GAGGAGAAGC CCGGTTCATAGCTCATCCTTGCTTGAAG-3¢...
  • 12
  • 348
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " Research Article A Generalized Approach to Linear Transform Approximations with Applications to the Discrete Cosine Transform" pptx

... specific transform (say DCT) approximation and distortion, there is no framework that enables us to systematically change the approximation in real-time to take advantage of additional computational ... set that adapts to the available computational resources We will show how to compute and embed metadata in the image as well as show a decoding algorithm to allow for adaptive approximation The ... evaluate the approximation candidate set Φ Then the optimal approximation candidate set Φ∗ (T) for an input set X for the linear X transform T is defined as the approximation candidate set with...
  • 17
  • 367
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " Research Article A Generalized Wirtinger’s Inequality with Applications to a Class of Ordinary Differential Equations" docx

... 139–164, 1978 J L Kaplan and J A Yorke, Ordinary differential equations which yield periodic solutions of differential delay equations,” Journal of Mathematical Analysis and Applications, vol 48, ... is a periodic solution of 1.2 with period T 2.20 2π Journal of Inequalities and Applications Acknowledgments The authors would like to thank the referee for careful reading of the paper and many ... Methods & Applications, vol 31, no 1-2, pp 45–54, 1998 10 J Llibre and A. -A Tarta, “Periodic solutions of delay equations with three delays via bi-Hamiltonian ¸ systems,” Nonlinear Analysis: Theory,...
  • 7
  • 238
  • 0

Xem thêm

Từ khóa: support vector machine active learning with applications to text classification pdflocal ports identify the application establishing a connection from other programs allowing multiple tcp applications to run on the same machinealgebra with applications to hypercomplex geometry•cation of synergies in multijoint movement with applications to gait analysisrespiratory aerosol dynamics with applications to pharmaceutical drug delivery2green tribology with applications to biorefineriesbiorefineriessearch and evolutionary scatter search for tree star network problems with applications to leased line network designschrödinger equations with applications to quantum dotsoption pricing with applications to real optionstarget tracking using probabilistic data association based techniques with applications to sonar radar and eo sekiaa0725p a novel pla 1 with sequence homology to a mammalian sec23p interacting protein p125a novel encounter with big dataa method with an application in severe sepsiscloning sequencing and expression of a novel goose type lysozyme gene with chitinase ra chic activity from the moderately thermophilic bacterium ralstonia sp a 471roentgen stereometric analysis a novel in vivo method to assess spinal fusionBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDENghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngThơ nôm tứ tuyệt trào phúng hồ xuân hươngChuong 2 nhận dạng rui roTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Nguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIĐổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ