Pharmacology of gemcitabine in the asian population

Pharmacology of gemcitabine in the asian population 1

Pharmacology of gemcitabine in the asian population 1

... , R12 , R 11 , R 21 , R22 ) such that R 11 ≤ I(X1 ; Y1|U0 , U1 , U2 ), (2.2) R12 + R 11 ≤ I(X1 ; Y1|U0 , U2 ), (2.3) R 11 + R 21 ≤ I(X1 , U2 ; Y1 |U0 , U1 ), (2.4) R12 + R 11 + R 21 ≤ I(X1 , U2 ; Y1 |U0 ... pairs (R1 , R2 ) such that R1 = R12 + R 11 and R2 = R 21 + R22 with any non-negative rate quintuple (R12 , R 11 , R 21 , R22 ) satisfying R 11 ≤ I(X1 ; Y1 |U1 , U2 , Q), (2.29...

Ngày tải lên: 11/09/2015, 16:04

168 182 0
Pharmacology of gemcitabine in the asian population

Pharmacology of gemcitabine in the asian population

... Review minute infusion of gemcitabine This corresponds to the saturation of the rate-limiting enzyme deoxycytidine kinase in the cell [18] In another study to determine if the saturation of dFdCTP ... rate infusion of 10 mg/m2/min of gemcitabine and standard 30-min infusion of 1000 mg/m2 was conducted Despite a 25% lower total dose of gemcitabine at an infusion...

Ngày tải lên: 11/09/2015, 16:04

204 156 0
báo cáo khoa học:" Multimorbidity and health-related quality of life in the older population: results from the German KORA-Age study" ppsx

báo cáo khoa học:" Multimorbidity and health-related quality of life in the older population: results from the German KORA-Age study" ppsx

... manuscript BT was involved in the coordination of the study and commented on drafts of paper MS was involved in the interpretation of data AD participated in the coordination of the study PM commented ... drafts of paper AP was involved in the conception of the study RH was involved in the conception of the study and assisted in writing the ma...

Ngày tải lên: 12/08/2014, 00:20

10 282 0
Báo cáo sinh học: " Estimation of heritability in the base population when only records from later generations are available" doc

Báo cáo sinh học: " Estimation of heritability in the base population when only records from later generations are available" doc

... when only data from these generations are available In the former case, the component of variance estimates the genetic variance in the base population, and in the latter the genetic variance in ... Proceeding in this way, estimates of the genetic variance in the base population are 10.18 (p 10%) and 10.23 (p = 25%) These values are very cl...

Ngày tải lên: 14/08/2014, 20:20

9 231 0
The Political Economy of Distress in East Asian Financial Institutions

The Political Economy of Distress in East Asian Financial Institutions

... Asia financial crisis a good event to investigate the role of these connections in causing and resolving financial institutions distress Furthermore, the general causes of the East Asian financial ... the percentage of institutions in distress (Table IV) Malaysia has fewer distressed institutions and did not close any financial institution The Philippi...

Ngày tải lên: 18/10/2013, 08:15

22 652 0
báo cáo hóa học: " Type D personality in the general population: a systematic review of health status, mechanisms of disease, and work-related problems" docx

báo cáo hóa học: " Type D personality in the general population: a systematic review of health status, mechanisms of disease, and work-related problems" docx

... Germany (n = 2), Canada, Ireland, Poland, and Ukraine The results of the studies included in this review are first described below according to the impact of Type D personality on mental and physical ... perceived health status, we also reviewed empirical and experimental evidence regarding the role of Type D personality in potential mechanisms of...

Ngày tải lên: 18/06/2014, 19:20

10 595 0
báo cáo hóa học: " Onset and persistence of person-perceived participation restriction in older adults: a 3-year follow-up study in the general population" pptx

báo cáo hóa học: " Onset and persistence of person-perceived participation restriction in older adults: a 3-year follow-up study in the general population" pptx

... restricted in an aspect of life if they did not participate in it "as and when they wanted" for "all" or "most of the time" The number of aspects of life, where responders indicated participation restriction, ... lost at follow-up had the same likelihood of participation restriction (examining onset and persistence separately), within strata defined by age...

Ngày tải lên: 18/06/2014, 19:20

11 498 0
báo cáo hóa học: " The assessment of health-related quality of life in relation to the body mass index value in the urban population of Belgrade" potx

báo cáo hóa học: " The assessment of health-related quality of life in relation to the body mass index value in the urban population of Belgrade" potx

... in the general population [25,26] Therefore, the aim of our research was to assess the association between the BMI value and health-related quality of life in the urban population of Belgrade http://www.hqlo.com/content/6/1/106 ... evaluating the quality of life have yielded similar results in overweight and obese subjects [24] However, very few s...

Ngày tải lên: 18/06/2014, 19:20

10 535 0
báo cáo hóa học:" Usefulness of five-item and three-item Mental Health Inventories to screen for depressive symptoms in the general population of Japan" ppt

báo cáo hóa học:" Usefulness of five-item and three-item Mental Health Inventories to screen for depressive symptoms in the general population of Japan" ppt

... one of the following responses: all of the time (1 point), most of the time (2 points), a good bit of the time (3 points), some of the time (4 points), a little of the time (5 points), or none of ... affected by their knowledge that they are subjects in a study of mental health Embedding the mental- health screening instrument in a more general surve...

Ngày tải lên: 20/06/2014, 15:20

7 547 0
báo cáo hóa học:" The assessment of health-related quality of life in relation to the body mass index value in the urban population of Belgrade" docx

báo cáo hóa học:" The assessment of health-related quality of life in relation to the body mass index value in the urban population of Belgrade" docx

... in the general population [25,26] Therefore, the aim of our research was to assess the association between the BMI value and health-related quality of life in the urban population of Belgrade http://www.hqlo.com/content/6/1/106 ... evaluating the quality of life have yielded similar results in overweight and obese subjects [24] However, very few s...

Ngày tải lên: 20/06/2014, 16:20

10 416 0
Báo cáo khoa học: "Targeted surveillance to assess the presence of BSE in the age risk population of cattle slaughtered in Bursa, Turkey: preliminary results of an immunohistochemical detection study for the 2004-2005 period" pdf

Báo cáo khoa học: "Targeted surveillance to assess the presence of BSE in the age risk population of cattle slaughtered in Bursa, Turkey: preliminary results of an immunohistochemical detection study for the 2004-2005 period" pdf

... gniwolloF nim 01 rof )001 : detulid ylhserf( 1.6.79/99F bAM lµ 001 htiw detabucni neht erew sedils ehT nim 5.1 yltcaxe rof deilppa saw emyzne eht fo lµ 001 ,tnemtaert K esanietorp eht roF reffub ... ,siraP ,EIO ,.31.3 retpahC de ht5 slaminA lairtserreT rof seniccaV dna stseT citsongaiD fo launaM :nI yhtapolahpecne mrofignops enivoB )EIO( seitoozipE sed lanoitanretnI eciffO 337-037 ,92 ,0002 l...

Ngày tải lên: 07/08/2014, 20:23

3 237 0
Báo cáo y học: " A promoter haplotype of the interleukin-18 gene is associated with juvenile idiopathic arthritis in the Japanese population" pps

Báo cáo y học: " A promoter haplotype of the interleukin-18 gene is associated with juvenile idiopathic arthritis in the Japanese population" pps

... FAM-TTTTGGTATCCCTCTCC-MGB SNP11F ACAGGTTTTGGAAGGCACAGA SNP11 VIC- ACGGAAGAAAAGATTT-MGB SNP11R AATAAAGTGGCAGAGGATACGAGTACT SNP11 FAM-ACGGAAGAAAACATTT-MGB SNP12F AATTGTCTCCCAGTGCATTTTGC SNP12 allele1 VIC-CTGCCAACTCTGGCTG-MGB ... SNP2 allele2 FAM-CACTTATCTGTAGAGCTT-MGB SNP4F CTGGCAATTCTGCCTTGTTTCAG SNP4 allele1VIC- CCGAAGATAAAAGAATC-MGB SNP4R GGATTACAGCCGTGAGCCA SNP4 allele2 FAM- CGAAGATAGAAGAAT...

Ngày tải lên: 09/08/2014, 07:20

9 559 0
Báo cáo y học: "Intraoperative device closure of atrial septal defects in the Older Population" pot

Báo cáo y học: "Intraoperative device closure of atrial septal defects in the Older Population" pot

... immediately after the release of device since they usually disappeared during follow-up period Page of This early shunting was associated with the loose-links between the occluding device and the rim of ... improvement in 6MWT distance, which is useful in the serial evaluation of patient status The most clinically relevant finding was the increase in exercise c...

Ngày tải lên: 10/08/2014, 09:22

7 425 0
Báo cáo y học: " Prevalence of hallux valgus in the general population: a systematic review and metaanalysis" pdf

Báo cáo y học: " Prevalence of hallux valgus in the general population: a systematic review and metaanalysis" pdf

... systematic review investigating the prevalence of HV and the influence of age and gender Therefore, the aim of this systematic review and meta-analysis was to examine HV prevalence in the overall ... supported by an Australian Postgraduate Award Scholarship at The University of Queensland, and funding for the cost of language translation was provide...

Ngày tải lên: 10/08/2014, 21:24

9 454 0
Báo cáo y học: "The clinical assessment study of the foot (CASF): study protocol for a prospective observational study of foot pain and foot osteoarthritis in the general population" docx

Báo cáo y học: "The clinical assessment study of the foot (CASF): study protocol for a prospective observational study of foot pain and foot osteoarthritis in the general population" docx

... methods of data-gathering In the clinical assessment phase of the study, the clinical interview and physical assessment, ultrasound, digital images, plantar pressure and the taking and scoring of ... line-drawings for each foot depicting increasing severity of hallux valgus In the past weeks, have you had pain that has lasted for one day or longer...

Ngày tải lên: 10/08/2014, 21:24

16 555 0
Từ khóa:
w