Identification and characterization of conserved regulatory elements by comparative genomics

Identification and characterization of conserved regulatory elements by comparative genomics

Identification and characterization of conserved regulatory elements by comparative genomics

... identifying functional cis -regulatory elements …….140 7.3 Cooperativity and redundancy in cis -regulatory elements ……………….142 7.4 Conserved function of cis -regulatory elements in mammals and fish without ... validation of functionally significant variants and pathological mutations in the regulatory regions of the genome 1.4 Identification of cis -regulatory ele...
Ngày tải lên : 11/09/2015, 16:02
  • 173
  • 327
  • 0
Báo cáo sinh học: "Identification of conserved regulatory elements by comparative genome analysis" docx

Báo cáo sinh học: "Identification of conserved regulatory elements by comparative genome analysis" docx

... promoters of co-regulated genes [10], and the improved discrimination of regulatory modules [11], as well as comparative studies of orthologous promoters across collections of microbial genomes ... phylogenetic footprinting with profile-based predictions of TFBSs, in order to achieve specific predictions of functional regulatory elements in genes As an example of the inf...
Ngày tải lên : 06/08/2014, 18:20
  • 11
  • 315
  • 0
Báo cáo y học: "A steganalysis-based approach to comprehensive identification and characterization of functional regulatory elements" potx

Báo cáo y học: "A steganalysis-based approach to comprehensive identification and characterization of functional regulatory elements" potx

... specificity and sensitivity (see Additional data file for a detailed analysis and more results) Identifying yeast cell-cycle regulatory motifs To evaluate the performance of WordSpy on biological ... analysis, WordSpy can comprehensively identify real motifs from a large set of regulatory sequences with a high specificity Identifying Arabidopsis cell-cycle regulatory motifs Ce...
Ngày tải lên : 14/08/2014, 16:21
  • 16
  • 598
  • 0
Identification and characterization of CIS regulatory elements for vertebrate developmental control genes

Identification and characterization of CIS regulatory elements for vertebrate developmental control genes

... locate and validate candidate cis- regulatory elements for developmental control genes that are ancient in origin and conserved in evolution 1.1 Cis- Regulatory Elements Cis- regulatory elements ... methods to locate and validate cis- regulatory elements 17 1.5 Genomics era methods to locate and validate cis- regulatory elements ……20 1.6 In silico predic...
Ngày tải lên : 14/09/2015, 08:40
  • 118
  • 278
  • 0
Báo cáo y học: "Identification and functional characterization of cis-regulatory elements in the apicomplexan parasite Toxoplasma gond" pptx

Báo cáo y học: "Identification and functional characterization of cis-regulatory elements in the apicomplexan parasite Toxoplasma gond" pptx

... regulatory questions in the actively multiplying tachyzoite, as any given population of cells in culture consists of parasites at different points of their cell cycle Our study reports the presence of ... a majority of the bases in each motif were substituted by base-specific transversions, thus destroying the original sequence of the candidate motif but maintainin...
Ngày tải lên : 14/08/2014, 21:20
  • 15
  • 312
  • 0
báo cáo khoa học: " Identification and characterization of wheat long non-protein coding RNAs responsive to powdery mildew infection and heat stress by using microarray analysis and SBS sequencing" ppsx

báo cáo khoa học: " Identification and characterization of wheat long non-protein coding RNAs responsive to powdery mildew infection and heat stress by using microarray analysis and SBS sequencing" ppsx

... as: Xin et al.: Identification and characterization of wheat long non-protein coding RNAs responsive to powdery mildew infection and heat stress by using microarray analysis and SBS sequencing ... response to biotic and/ or abiotic stresses in wheat Results Identification of powdery mildew infection and heat stress responsive...
Ngày tải lên : 11/08/2014, 11:21
  • 13
  • 417
  • 0
Báo cáo y học: "Fast and systematic genome-wide discovery of conserved regulatory elements using a non-alignment based approach" ppsx

Báo cáo y học: "Fast and systematic genome-wide discovery of conserved regulatory elements using a non-alignment based approach" ppsx

... AATACATGATGAAACAcatATGAAAAAaa-aagcttttctacatattcgaggg-tttttttctgTTGGTGGa-tac TATTTAA-gaagtg AGTACATGATGAAACAcTTATAAAAaaaataagctttcTTACATGGTCTCGAGGgTTTTTCCAgctatagaaatacTATTTAAaggactA * ****** ... ctcgtgcattaagacaggctagtaTAAACGAGAAGAAGtatcctgctttgcaa TGAAACAATAGtatc-cgctaagaatttaagcaggcc tccacgcatggggattgctTGAAGAAaataggaagaaccg-gctgc TTCAACATGAAACAtcagtactatactgtcaactcctgtaggct PAR ctcctg-agta...
Ngày tải lên : 14/08/2014, 14:21
  • 27
  • 276
  • 0
Tài liệu Báo cáo khoa học: Phenol hydroxylase from Acinetobacter radioresistens S13 Isolation and characterization of the regulatory component docx

Tài liệu Báo cáo khoa học: Phenol hydroxylase from Acinetobacter radioresistens S13 Isolation and characterization of the regulatory component docx

... aminoacids at the N-terminus of PHI (sequence: SKVYLALQDND) were compared with the sequences of the so called ‘intermediate components’ from two other PHs The N-terminal sequence of PHI from A radioresistens ... one PHR and one PHO (abc) protomer The hypothesis of a direct PHI phenol interaction is quite unlikely, because of the fact that the addition of ph...
Ngày tải lên : 21/02/2014, 00:20
  • 7
  • 514
  • 0
synthesis and characterization of wo3 nanostructures prepared by an aged-hydrothermal method

synthesis and characterization of wo3 nanostructures prepared by an aged-hydrothermal method

... Fig – XPS Spectra of WO3 nanostructures: a) O1 s and b) W4 f axis with an inter-planar distance of 0.38 nm Raman, EDS and XPS analysis confirmed that the chemical structure and oxidation states ... procuring WO3 nanostructures is a modification of the method reported by Albiter et al for MoO3 nanorods [20] and Therese et al for WO3 nanostructures [18] The main d...
Ngày tải lên : 20/03/2014, 13:08
  • 6
  • 443
  • 0
Báo cáo Y học: Identification and characterization of thioredoxin and thioredoxin reductase fromAeropyrum pernixK1 pdf

Báo cáo Y học: Identification and characterization of thioredoxin and thioredoxin reductase fromAeropyrum pernixK1 pdf

... transhydrogenase assay described by Gan et al [25] Cloning of the two genes from A pernix K1 Thioredoxin reductase activity assays Assays for thioredoxin reductase activity were carried out by two ... 2002 Thioredoxin system of Aeropyrum pernix (Eur J Biochem 269) 5425 Thioredoxin activity assays RESULTS Thioredoxin activity was determined by the insulin precipitation assay...
Ngày tải lên : 23/03/2014, 21:20
  • 8
  • 414
  • 0
Báo cáo sinh học: " CODEHOP-mediated PCR – A powerful technique for the identification and characterization of viral genomes" pptx

Báo cáo sinh học: " CODEHOP-mediated PCR – A powerful technique for the identification and characterization of viral genomes" pptx

... TTTGACCTGGAGACTATGttymgngartayaa ACCTTCATCAAAAATCCCttnggnggnatgyt GACGACCGCAGCGTGTGCGTGaaygtnttyggnca TAAAAGTACAGCTCCTGCCCGaanacrttnacrca TTAGCTACTCCGTGGAGCagyttrtcraarta GAAGTGGCAGTTGGAGAGGCTGACCTCCcartcncc ... GTGGTCGATTTTGCCAGCCTGTACCCGAGCATCATCCAGGCGCACAACCTGTGC GTAGTAGACTTTGCTAGCCTGTATCCTAGTATTATACAAGCTCATAATCTATGC GTGGTGGACTTTGCCAGCCTGTACCCCACCATCATCCAGGCCCACAACCTCTGC GTAGTGGACTTTGCCAGC...
Ngày tải lên : 18/06/2014, 22:20
  • 24
  • 604
  • 0
báo cáo hóa học:" Identification and characterization of a spontaneous ovarian carcinoma in Lewis rats" docx

báo cáo hóa học:" Identification and characterization of a spontaneous ovarian carcinoma in Lewis rats" docx

... of proband Intraperitoneal tumor arising spontaneously in a Lewis rat has pathologic appearance of an ovarian adenocarcinoma (A) Proband shows tumor of the left ovary and intraperitoneal tumor ... D, Atkins L, Kato DT, Buczek-Thomas J, Fuller AF Jr, Hasan T: Characterization of a xenograft model of human ovarian carcinoma which produces intraperitoneal carcinomatos...
Ngày tải lên : 20/06/2014, 07:20
  • 8
  • 440
  • 0
Báo cáo hóa học: " Identification and characterization of alkaline serine protease from goat skin surface metagenome" docx

Báo cáo hóa học: " Identification and characterization of alkaline serine protease from goat skin surface metagenome" docx

... al.: Identification and characterization of alkaline serine protease from goat skin surface metagenome AMB Express 2011 1:3 Submit your manuscript to a journal and benefit from: Convenient online ... and Gly-Thr-SerMet-Ala-X-Pro, which is characteristic of serine subfamily S8A Results from the sequence analysis of this protease suggested it to be serine...
Ngày tải lên : 21/06/2014, 05:20
  • 10
  • 426
  • 0
Báo cáo sinh học: "Small-molecule modulators of Hedgehog signaling: identification and characterization of Smoothened agonists and antagonists." pps

Báo cáo sinh học: "Small-molecule modulators of Hedgehog signaling: identification and characterization of Smoothened agonists and antagonists." pps

... approach of identifying and studying the mechanism of action of small-molecule agonists (and antagonists), we hoped to uncover some of the complexities of the Hh-signaling system Small-molecule modulators ... activation with a Hh-protein ligand has therapeutic value [49,50] On the basis of our current understanding of these models and the specific mechanism of action...
Ngày tải lên : 06/08/2014, 18:20
  • 19
  • 322
  • 0