Arsenic trioxide in ovarian cancer

... Chemotherapy The most active chemotherapy agents in ovarian cancer are the platinum analogues, cisplatin and carboplatin The antitumor activity of cisplatin (cis-diamminedichloroplatinum (II)) was ... platinum-sensitive human ovarian cancer cell line OVCAR They also appeared to slow the growth of the cisplatin- sensitive human ovarian cancer cells GG and JAM [...

Ngày tải lên: 20/06/2014, 07:20

... VE-465 alone or in combination with 15 ng/mL paclitaxel (Fig 4E) VE-465 Synergizes with paclitaxel to induce apoptosis at low doses specific to Aurora- A We observed increased apoptosis at low doses ... phosphorylation of a known mitotic marker in ovarian cancer cells VE-465 Induces Apoptosis in Ovarian Cells We hypothesized that treatment with VE-465 would...

Ngày tải lên: 18/06/2014, 15:20

... sialylation of β1 integrins in three ovarian carcinoma Figure cell lines2 α2–6 sialylation of β1 integrins in three ovarian carcinoma cell lines.A, Lysates from PA1, OV4, and SKOV3 cells were incubated ... floating ovarian carcinoma cells would encounter, adhere to, and subsequently invade [35] β1 integrin' s importance in the metastasis of ovarian cancer has been rep...

Ngày tải lên: 20/06/2014, 07:20

... nutritional assessment in cancer The current study was undertaken to investigate if SGA, a potential indicator of nutritional status, could predict survival in ovarian cancer In this study, we found ... Krogstad K, Kaasa S, Falkmer UG: Nutritional status of patients with advanced cancer: the value of using the subjective global assessment of nutritional...

Ngày tải lên: 20/06/2014, 07:20

... activates SMAD 1/5/8 and Erk MAPKs in ovarian cancer cell lines To investigate the role of BMP-2 in ovarian cancer cells we selected three cell lines, TOV-2223, TOV-1946 and TOV112D, for in vitro assays ... cells of many origins including cancers arising from thyroid, androgen-dependent prostate in presence of androgen, myeloma, gastric and pancreatic cells [14,18-22]...

Ngày tải lên: 20/06/2014, 07:20

... greater accuracy in diagnosis, staging, and management decisions in ovarian cancer In this review article, the role of FDG-PET and FDG-PET/ CT in the diagnosis, staging, and management of ovarian cancer ... patients with early mucinous adenocarcinoma and borderline mucinous adenocarcinoma Rieber et al reported that early carcinomas, mucinous adenocarcinomas, and particul...

Ngày tải lên: 20/06/2014, 07:20

... α-tubulin antibody as a loading control Expression of estrogen receptors and STYK1 in ovarian cancer cell lines We detected ER- RNA expression in ovarian cancer cell lines SKOV3, CaOv3, and OvCar3 ... entering the cell, STYK1 expression increased relative to estradiolinduced expression in OvCar5 cells but decreased in OvCar8 cells There was no appreciable...

Ngày tải lên: 20/06/2014, 07:20

... ovarian tumors and their potential role in ovarian cancer diagnosis and treatment Mucins Being that 90% of ovarian cancers are of epithelial origin, mucins may be attractive candidates for the ... of ovarian cancer and ovarian cancer prognosis Use of Mucins in Radioimmunodiagnosis (RID) and Radioimmunotherapy (RIT) Monoclonal antibodies against mucins may...

Ngày tải lên: 20/06/2014, 07:20

... article as: Yallapu et al., Curcumin induces chemo/radio-sensitization in ovarian cancer cells and curcumin nanoparticles inhibit ovarian cancer cell growth Journal of Ovarian Research 2010, 3:11 ... of cisplatin treatment in cisplatin resistant cells by increasing the sensitivity of cells to apoptotic pathways and modulating nuclear β-catenin signaling...

Ngày tải lên: 20/06/2014, 07:20

... of Ovarian Research 2010, 3:19 http://www.ovarianresearch.com/content/3/1/19 A combination of doxorubicin, cyclophosphamide, and cisplatin resulted in an increase of 6% in the survival rate of ... al: Gemcitabine plus vinorelbine compared with cisplatin plus vinorelbine or cisplatin plus gemcitabine for advanced non-small-cell lung cancer: a phase III trial of the Italian GEM...

Ngày tải lên: 20/06/2014, 07:20

... doi:10.1186/1757-2215-3-22 Cite this article as: Gupta et al.: Longitudinal monitoring of CA125 levels provides additional information about survival in ovarian cancer Journal of Ovarian Research 2010 3:22 Submit your ... who are well into the course of their disease Consequently, our findings lend support to the importance of regular monitoring of CA125...

Ngày tải lên: 20/06/2014, 07:20

... cancer cells [8] and stabilizes the HER2 oncoprotein in pancreatic cancer cells [7] In the present study, we analyzed the expression of the HER2 protein in MUC4transfected ovarian cancer cells The ... exogenous MUC4 expression in ovarian cancer cells showed an increase in HER2 expression and colocalization, suggesting that MUC4 is involved...

Ngày tải lên: 20/06/2014, 07:20

... HOX genes in ovarian cancer cell lines were found, the most common being HOXB7, HOXA13 and HOXB13 Overexpression varied between cell lines but of these 16 genes, Figure Role of HOX genes in ovarian ... as HOXB13 promoted tumourgenesis in ovarian cancer cell lines containing genetic alterations in p53, myc and K-ras but not in cell lines containing genetic alterations...

Ngày tải lên: 20/06/2014, 08:20

... ggatccatttaggtgacactatagaagtacctgaaaggaagcttttttttttcg aggatttcctgtatttattaagttacaagttggcaggcacagcttgagcaacat agaaaagtaatcttcttgagttatacaatcatttaaattccaaagcactcacaa aattgagcaaacaaagccactatttgcatatttgggaaaggaaacatattgct ... ttacaagttggcaggcacagcttgagcaacatagaaaagt aatcttcttgagttatacaatcatttaaattccaaagcactcacaaaattgagca aacaaagccactatttgcatatttgggaaaggaaa-3’) The membrane was hybridized in...

Ngày tải lên: 08/08/2014, 17:20