Application of novel gate materials for performance improvement in flash memory devices

... objective of this work is to apply novel gate materials for the performance enhancement of flash memory devices, including both floating gate- type flash memory devices and SONOS-type flash memory devices ... enhancement of flash memory devices, including both floating gate- type flash memory devices and SONOS-type flash memory devices These...

Ngày tải lên: 11/09/2015, 14:24

... reducing gases [12] To investigate the oxidation activity of synthesized and commercial materials, we performed TPR study of SnO2 with and without Pd (Fig 6) TPR profile of the synthesized SnO2 displays ... target gas is of the same order of magnitude as the resistance of the sensors on the basis of commercial SnO2 The use of synthesized SnO2 results in the highest...

Ngày tải lên: 19/03/2014, 16:47

... CHEMFET of BIOFET In all of these devices, the surface potential developed at the surface of the semiconductor is based on the direct interaction of the ligand with the exposed atoms of the semiconductor, ... maturation with the commercialization of these pH sensors in the mid-80’s, while they were the platform for the development of other ion-select...

Ngày tải lên: 20/03/2014, 13:05

... this article as: Hiyama et al.: Application of a MANET Testbed for horizontal and vertical scenarios: performance evaluation using delay and jitter metrics Human-centric Computing and Information ... work, we investigate the performance of a MANET testbed for horizontal and vertical topologies We implemented seven MANET scenarios and eva...

Ngày tải lên: 21/06/2014, 06:20

... focused on the analysis of DNA fragments; and the second part (chapter and chapter 5) focused on the analysis of organic pollutants Several novel capillary electrophoresis (CE) techniques had ... various applications, the CE applications in DNA analysis and monitoring of pollutants are of significant importance 1.3.1 CE Application in DNA Analysis...

Ngày tải lên: 14/09/2015, 11:40

... through the application of the model in assessing the English version of the Law on Investment 2005 of Vietnam and conclusions based on the findings Finally, implications for translating Vietnamese ... at assessing the quality of the English translation of the Law on Investment of Vietnam Therefore, a set of parameters for a...

Ngày tải lên: 07/11/2012, 14:36

... study, the ozone and UV combination (ozone/UV) process is applied for the reuse of sewage effluent Therefore, the aim of this study is to evaluate the effectiveness of ozone/UV process for the treatment ... considered in the treatment of sewage effluent water A relatively high water quality must be achieved with the end goal of reusing the sewa...

Ngày tải lên: 05/09/2013, 08:40

... towards recording, rmance against standards, processing, summarising examining and analysing and reporting of financial deviations, taking corrective data actions and reappraising standards based ... Gram Panchayat members, particularly Panchayat Secretary and the Sarpanch and update them about the plan of conducting an audit The Social Auditor should also use relevant secondary d...

Ngày tải lên: 06/03/2014, 23:20

... employed The system allows for sample rotation (360◦ ) and sample inclination (90◦ ) 2.4 Gas sensing measurements The gas sensing properties of the different hybrid active materials produced were ... higher amount of SnO2 than WO3 is present in the hybrid materials 3.2 Gas response analysis The gas sensing properties of the different hybrid materials produced were...

Ngày tải lên: 20/03/2014, 13:05

... into tens of thousands of patterns, we chose to study context- sensitive g r a m m a r in the ordinary context of sequential parsing with a hash-table representation of the grammar, and a scoring ... only 80% of the constituents of a new sentence will be recognized, and thus the probability of a correct parse for a sentence never seen before is very small We experime...

Ngày tải lên: 31/03/2014, 06:20

... biomarkers, and they participated in the data analyses AAH developed the customized Spotfire tool used for data analyses and reviewed statistical analyses YG participated in the assessment and ... assay for determining the pharmacodynamic activity of an antagonist candidate biotherapeutic antibody to IL21R in whole blood Journal of Translati...

Ngày tải lên: 18/06/2014, 16:20

... AGGAAAAAAATTTAAATCCACCATGGTGAGCAAGGGCGA GGAGCT AGGAAAAAAATCGATCGCGTTAAGATACATTGAGTTTGGA C PCR to check pAd 5CMV- EGFP GGCACCAAAATCAACGGGAC AGGAAAAAAATCGATCGCGTTAAGATTACATTGAGTTTGGA C Amplification of TK from pMBP-TK AGGAAAAAAATTTAAATGCGCGTATGGCTTCGTAC ... GATAACAGATTTAAATCCTTCGAACAGAATCGAT GGCCATCGATTCTGTTCGAAGGATTTAAATCTGTT PCR to check pAd 5CMV/ TCS CGTGTCATATGGATACACGGG TCCAGCATGGCTACAAC...

Ngày tải lên: 20/06/2014, 01:20

... rise of compressor are investigated to study the effects of inlet parameters on the compressor performance and characteristics Figure 4.16 indicates that a smaller inlet flow angle causes a higher ... vertical distorted velocity coefficient propagates along axial direction at higher inlet incident angles, θ ≥ 25° In Fig 4.6, smaller inlet incident angle induces a larger...

Ngày tải lên: 21/06/2014, 21:20