Detection and resolution enhancement of laser induced fault localization techniques 1

... lock-n detection assuming T1 /   DUT 16 9 17 1 17 2 17 3 17 3 17 4 17 5 17 9 18 0 18 1 18 2 18 2 18 3 18 5 19 3 19 4 xxii Chapter _ Chapter 1: Failure Analysis and Fault Localization ... Narrowband Lock-In Detection 11 1 11 5 5.2 .1. 1 DC-Coupled Detection Systems 11 5 5.2 .1. 2 AC-Coupled Detection Systems 11 7 5.2.2 Wideband Lock-In Detection 12 0...

Ngày tải lên: 11/09/2015, 09:58

... ac   2 v d Av (2  x)  sin (2n  1) o t d  1 y 1 z    2 2   (To  2t d ) n 1 2n  1  (2n  1) (2  )  (2n  1) (2  )    A(1  x)   2 1  (2n  1) (2  )   2 v d Av ... 1  (2n  1) (2  )      B (1  y ) 2  x  , 2   (2n  1) (2  )     C (1  z )  2    (2n  1) (2  )  (5.17a) ac b2 n 1 ( o )    (2n  1)(1  y )  2 4vd A...

Ngày tải lên: 11/09/2015, 09:58

... FAULT DETECTION AND CORRECTION MODELING OF SOFTWARE SYSTEMS WU YANPING (B.S., USTC) A THESIS SUBMITTED FOR THE DEGREE OF DOCTOR OF PHILOSOPHY DEPARTMENT OF INDUSTRIAL AND SYSTEMS ENGINEERING ... detection and correction process Software reliability modeling is to describe fault- related behaviors of software testing process, which generally includes f...

Ngày tải lên: 11/09/2015, 16:06

... ADAPTIVE FAULT DETECTION AND CONDITION MONITORING OF INDUCTION MOTOR LU WENJING (B.ENG NUS) A THESIS SUBMITTED FOR THE DEGREE OF MASTER OF ENGINEERING DEPARTMENT OF ELECTRICAL AND COMPUTER ... for fault detection under various operating conditions because of the dependency of motor fault feature on the operating condition Most of the papers limit thei...

Ngày tải lên: 26/09/2015, 10:59

... kinetics and mechanism of liver alcohol dehydrogenase with primary and secondary alcohols as substrates Biochem J 100, 34–46 ´ 36 Branden, C.I., Jornvall, H., Eklund, H & Furugen, B (1975) ¨ ¨ Alcohol ... explain the decrease of CSM for this range of pressure and hence the increase of polarity of the environment of Trp314 Moreover, pressure could also induce a reduct...

Ngày tải lên: 23/03/2014, 20:22

... brain edema Neurobiol Dis 1999, 6: 245 -258 doi:10.1186/1 742 -20 94- 8- 143 Cite this article as: Tourdias et al.: Differential aquaporin expression during edema build-up and resolution phases of brain ... = 49 ) and by evaluating the longitudinal data for each animal (Figure 1), the time course of edema build-up and resolution phases was confirmed B...

Ngày tải lên: 19/06/2014, 22:20

... estimation of multicomponent LFM signal can be realized by the CPF The principle of detection and parameters estimation of single LFM signal is presented For multicomponent LFM signal, the CLEAN ... detection of the “autoterms.” Remark The phase information of the LFM signal is neglected in this paper, because in most situations, the char...

Ngày tải lên: 21/06/2014, 22:20

... Award of Excellence in Teaching at the University of Dayton and was the recipient of the first Professor of the Year Award in 2002 from the student chapter of the IEEE at the University of Dayton ... College of Nursing, and the Department of Psychology Within this center, Dr Schultz helps supervise the design of unmanned aerial vehicle payloads and sensors, conducts research...

Ngày tải lên: 22/06/2014, 19:20

... of infectious bronchitis virus isolated in the UK Vet Rec 2008, 162, 99-100 11 Gough RE, Randall CJ, Dagless M, Alexander DJ, Cox WJ, Pearson D A ‘new’ strain of infectious bronchitis virus infecting ... region of the S1 gene of infectious bronchitis virus Arch Vrol 2000, 145, 291-300 Yu L, Wang Z, Jiang Y, Low S, Kwang J Molecular epidemiology of infectious...

Ngày tải lên: 07/08/2014, 23:22

... may develop as a result of antithyroid drug therapy [3] Authors generally agree that DIV syndromes have a better long-term prognosis mostly because of lesser renal involvement Arthralgias and ... Ono K, Narabara N, Yano S, Naruse T, Takenouchi K, Yasumoto Y: Case of propylthiouracilinduced vasculitis associated with anti-neutrophil cytoplasmic antibody (ANCA); review of literatur...

Ngày tải lên: 09/08/2014, 07:20

... have investigated skin permeation mechanism of many drugs using chemical enhancers [14-21] and microemulsion technique [22,23] Best of our knowledge, skin permeation mechanism of celecoxib has not ... and their mechanism of action J Control Rel 2004, 95:367-379 Cole L, Heard C: Skin permeation enhancement potential of aloe vera and a proposed mechanism...

Ngày tải lên: 11/08/2014, 00:22

... Rev5'TACCTCCTGGCTTCAACCAT; P5 CSFor5'GATGTTTTTGCTGCCATTGA, Rev5' GC TAATC CC AACCTCAGCAC; DnaJ-For5'GGAATACAGGAGGGG GA CAT, Rev5'CCTTTTGGGAGAACCAAACA; BADH-For5' TGGAAAATTGCTCCAGCTCT, Rev5'CTGGACCTAATCCC GTCAAA; ... glycinebetaine synthesis even in the plants not accumulating glycinebetaine naturally, like Arabidopsis thaliana, Brassica napus and Nicotiana tobacum [98] Moreover, modelling...

Ngày tải lên: 12/08/2014, 03:20

... samples JA and RC, performed the PCR and phylogenetic analysis All authors read and approved the final manuscript Indian orf viruses isolated from sheep and goats Vet Microbiol 2006, 116:317-24 Chan ... detection and partial sequencing of the B2L gene of a Brazilian ORFV isolate This is the first report on the phylogenetic analysis of ORFV in Brazil Case pr...

Ngày tải lên: 12/08/2014, 04:21

... VILI and is an antecedent of BPD in very preterm infants Our results indicate that increased CYR61 expression may play a key role in initiating the cascade of events caused by VILI, as CYR61 ... pathways involved [9,15] Identifying the initial injury pathways is critical as the greatest risk of injury may be during the period immediately after birth when the lungs are part...

Ngày tải lên: 12/08/2014, 14:20

... cloprostenol induced early abortions in heifers, the clinical features and patterns of prostaglandin F2α metabolite (PG metabolite) were categorized into two: after 100 days and before 75 days of pregnancy ... Pregnancy-specific protein B in serum of postpartum beef cows J Anim Sci 1993, 71:2199-2205 Lindell J-O, Kindahl H, Edqvist L-E: Prostaglandin induced early ab...

Ngày tải lên: 12/08/2014, 18:21