The generation of native human monoclonal antibodies with neutralising activity for dengue virus 1

The generation of native human monoclonal antibodies with neutralising activity for dengue virus 2

The generation of native human monoclonal antibodies with neutralising activity for dengue virus 2

... 1.1.5.4 Virus assembly and propagation 17 1.1.6 Phylogeny of Dengue Virus 19 1.1.7 Pathogenesis of Dengue Virus 22 1.1.8 Immune response to Dengue Virus 26 1.1.8.1 Innate immunity to DV 26 1.1.8 .2 ... culture 62 2.8 Source of primary CD 22+ B cells 63 2. 9 RNA extraction and RT-PCR for serotyping of patients 63 2. 10 Cloning of B cells from Dengue virus- i...

Ngày tải lên: 11/09/2015, 09:56

17 239 0
The generation of native human monoclonal antibodies with neutralising activity for dengue virus 3

The generation of native human monoclonal antibodies with neutralising activity for dengue virus 3

... on the surface of the virus There are a number of different mechanisms postulated to prevent virus from entering the cell One way is for antibodies to alter the spatial distances 33 between the ... 6.0) of the trans Golgi network triggers dissociation of the prM/E heterodimers, which leads to the formation of 90 dimers that lie flat on the surface of th...

Ngày tải lên: 11/09/2015, 09:56

199 317 0
GENERATION AND CHARACTERIZATION OF HUMAN MONOCLONAL ANTIBODIES WITH NEUTRALIZING ACTIVITY FOR DENGUE VIRUS

GENERATION AND CHARACTERIZATION OF HUMAN MONOCLONAL ANTIBODIES WITH NEUTRALIZING ACTIVITY FOR DENGUE VIRUS

... classification for dengue severity The new classification for dengue severity is divided into Dengue without Warning Signs, Dengue with Warning Signs, and Severe Dengue 24 1.2 Molecular Biology of DENV ... Fisher and Prof Leo Yee Sin, thank you for recruiting patients for our study To Prof Mary Ng and Boon, thank you for providing us with technical advice and...

Ngày tải lên: 09/09/2015, 08:16

201 644 0
Báo cáo y học: "Consolidating the set of known human protein-protein interactions in preparation for large-scale mapping of the human interactome" ppt

Báo cáo y học: "Consolidating the set of known human protein-protein interactions in preparation for large-scale mapping of the human interactome" ppt

... the list of human interactions, we turned to literature mining We adopted the strategy of separately identifying the protein names in the abstracts and then matching up the interacting protein ... Combination of the interaction data creates a consolidated set of 31,609 interactions between 7,748 human proteins On the basis of this initial set of interac...

Ngày tải lên: 14/08/2014, 14:21

12 208 0
Báo cáo khoa học: A strategy for the generation of specific human antibodies by directed evolution and phage display An example of a single-chain antibody fragment that neutralizes a major component of scorpion venom docx

Báo cáo khoa học: A strategy for the generation of specific human antibodies by directed evolution and phage display An example of a single-chain antibody fragment that neutralizes a major component of scorpion venom docx

... City, CA, USA) Isolation of anti-Cn2 scFv by panning of phage- antibody repertories The library of human scFv was displayed on filamentous phage and used for the selection of antibodies against ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTAATTTTATGCTGACTCAGCCCCA CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTGCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAAGAGACGGTG...

Ngày tải lên: 23/03/2014, 13:20

11 680 0
Báo cáo y học: "The critical role of arginine residues in the binding of human monoclonal antibodies to cardiolipin" ppsx

Báo cáo y học: "The critical role of arginine residues in the binding of human monoclonal antibodies to cardiolipin" ppsx

... a single experiment only are shown in Figs 2,3,4 The importance of arginine residues in IS4VH As reported previously, the presence of the heavy chain of IS4 plays a dominant role in binding to ... 94 in CDR3 of UK4VL hinders DNA binding sterically A similar effect may be occurring with regards to the binding of UK4VL to CL The effect of point mu...

Ngày tải lên: 09/08/2014, 06:22

10 501 0
Báo cáo y học: " Generation and characterization of high affinity human monoclonal antibodies that neutralize staphylococcal enterotoxin B" ppsx

Báo cáo y học: " Generation and characterization of high affinity human monoclonal antibodies that neutralize staphylococcal enterotoxin B" ppsx

... al.: Generation and characterization of high affinity human monoclonal antibodies that neutralize staphylococcal enterotoxin B Journal of Immune Based Therapies and Vaccines 2010 8:9 Submit your ... HuMAbs neutralize SEB-induced cytokine production by human lymphocytes To examine the biological activity of HuMAbs in vitro, a cell-based assay was employed t...

Ngày tải lên: 11/08/2014, 08:21

9 392 0
báo cáo hóa học:" Characterization of the tumor marker muc16 (ca125) expressed by murine ovarian tumor cell lines and identification of a panel of cross-reactive monoclonal antibodies" docx

báo cáo hóa học:" Characterization of the tumor marker muc16 (ca125) expressed by murine ovarian tumor cell lines and identification of a panel of cross-reactive monoclonal antibodies" docx

... MOVCAR-9 MOVCAR-10 MOVCAR-1 MOVCAR-2 MOVCAR-9 MOVCAR-10 Figure Extra -and intracellular Muc16 expression by MOVCAR cells Extra -and intracellular Muc16 expression by MOVCAR cells (A) MOVCAR-10 cells ... cDNA was prepared cDNA was amplified with the following primer pairs from Integrated DNA Technologies: Muc16 5'-TGCCACCTACCAGTTGAAAG-3' and 5'-GTACCGCCAAGCAGATGAG-3'; GAPDH 5'-...

Ngày tải lên: 20/06/2014, 07:20

7 430 0
Báo cáo y học: " HIV-1 neutralization by monoclonal antibody against conserved region 2 and patterns of epitope exposure on the surface of native viruses" pot

Báo cáo y học: " HIV-1 neutralization by monoclonal antibody against conserved region 2 and patterns of epitope exposure on the surface of native viruses" pot

... P05877 ABY26917 AY669700 AAT675 32 219 22 0 22 1 22 2 22 3 22 4 22 5 22 6 22 7 22 8 22 9 23 0 23 1 23 2 23 3 23 4 23 5 23 6 23 7 23 8 23 9 24 0 D C2E 21 8 E P I P I H Y C T P A G Y A I L K C N D K N E F E E E F E ... 92BR 025 DU174 SF1 62 QH06 92 IIIB MN VI191 92RW009 92UG 024 AE AE AE C C B B B B A A D AAW57 720 AY 621 208 AY 621 222 AAB61 124 DQ411853 P19550 AY6...

Ngày tải lên: 11/08/2014, 08:21

8 446 0
Báo cáo y học: "Increased bleeding risk associated with the use of recombinant human activated protein C in patients with advanced liver diseas" potx

Báo cáo y học: "Increased bleeding risk associated with the use of recombinant human activated protein C in patients with advanced liver diseas" potx

... that they may be at greatly increased risk for bleeding while receiving APC Because such patients were excluded from the major clinical trials of APC, it may be prudent to withhold therapy with ... epistaxis In a multivariate regression model that included race, sex, and Acute Physiology and Chronic Health Evaluation II score, cirrhosis remained independently associated with...

Ngày tải lên: 13/08/2014, 08:21

2 269 0
The application of games in teaching grammar with reference to tieng anh 10 textbook at ha trung high school, thanh hoa province

The application of games in teaching grammar with reference to tieng anh 10 textbook at ha trung high school, thanh hoa province

... 2.1 Ha Trung high school and current situation of teaching and learning English at the school 2.1.1 Ha Trung high school 10 Ha Trung high school is one of the leading schools in Thanh Hoa province ... deals with the theories of the role of grammar, students’ motivation, and the application of games in teaching grammar It is impo...

Ngày tải lên: 07/11/2012, 14:44

39 1,6K 8
Refusals to invitations the use of vietnamese learners of english and the use of native speakers of english  a comparison

Refusals to invitations the use of vietnamese learners of english and the use of native speakers of english a comparison

... groups of participants: Vietnamese learners of English and native speakers of English For the Vietnamese group, we contacted most of the Vietnamese participants in person and some via e-mail to ask ... (Journal of Japanese Language Teaching), 87, 25 - 39 Lauper, J A (1997) Refusal strategies of native English speakers in Spanish and in English...

Ngày tải lên: 07/09/2013, 13:31

44 1,2K 4
A STUDY ON THE TRANSLATION OF ENGLISH HUMAN RESOURCE MANAGEMENT TERMS INTO VIETNAMESE

A STUDY ON THE TRANSLATION OF ENGLISH HUMAN RESOURCE MANAGEMENT TERMS INTO VIETNAMESE

... Resource Management and Human Resource Management term I An overview of Human Resource Management The definition of Human Resource and Human Resource Management in Vietnam What is Human Resource Management? ... have long known to translators They are: SL Emphasis TL Emphasis Word-for-word translation Adaption Literal translation Free translation Fait...

Ngày tải lên: 11/12/2013, 23:55

70 813 1
Tài liệu The Language of Love: Deepen Your Relationship With Loving Communication pdf

Tài liệu The Language of Love: Deepen Your Relationship With Loving Communication pdf

... Each Other 13 The quest for love may be exciting, but the journey you embark on once you've found true love is much more spectacular… The Language of Love: Deepen Your Relationship With Loving ... Give them your full attention Turn off the computer, put down your book, turn down the TV – whatever is necessary to show them that they have your complete attention...

Ngày tải lên: 26/01/2014, 15:20

14 443 0
Từ khóa:
w