CD8 t cell mediated induction of interleukin 12p70 production by dendritic cells
... the elimination of infected and tumor cells CD8 T cells start off as naïve T cells that circulate the body after development in the thymus CD8 T cells are activated by encounter with antigen, which ... Lambrecht, 2008) Stimulation of epithelial cells via PRRs results in the production of thymic stromal lymphopoietin (TSLP) that directly activates DCs to prime CD4...
Ngày tải lên: 11/09/2015, 09:11
... presentation of TAA to cognate T cells by professional antigen-presenting cells (APC) Dendritic cells (DC) are professional antigen presenting cells (APC) with exquisite capability to activate naive T cells ... hence induction of primary immune response DC, loaded with antigen ex vivo, have been shown to induce potent anti- tumor response [1-2] The generation of clinically...
Ngày tải lên: 16/09/2015, 15:54
... immune assays and to build reagent panels able to accurately characterize the phenotype and function of responding T-cells More importantly, the ICS assay can be used as primary assay to evaluate HIV-1-specific ... increase the simultaneous measurement of cytokines for this kind of assays On the other hand, the introduction of new reagents, instruments and software,...
Ngày tải lên: 10/08/2014, 05:21
báo cáo hóa học:" Protective CD8+ T-cell responses to cytomegalovirus driven by rAAV/GFP/IE1 loading of dendritic cells" pdf
... Figure Cytotoxicity assay Cytotoxicity assay Multiple AAV vectors for DC loading and the autologous targets generated using the IE1 subgenes Targets were generated by viral loading of the IE1 ... Generation of cytomegalovirus- specific human Tlymphocyte clones by using autologous B-lymphoblastoid cells with stable expression of pp65 or IE1 proteins: a tool to study the fine s...
Ngày tải lên: 18/06/2014, 15:20
Báo cáo hóa học: "Comparison of anti-CD3 and anti-CD28-coated beads with soluble anti-CD3 for expanding human T cells: Differing impact on CD8 T cell phenotype and responsiveness to restimulation" pot
... Comparison of T cell size after stimulation with anti-CD3/ CD28 beads or anti-CD3 To gain additional insight into the relative impact of beads and anti-CD3 on cells, we serially monitored forward ... Cite this article as: Li and Kurlander: Comparison of anti-CD3 and antiCD28-coated beads with soluble anti-CD3 for expanding human T cells: D...
Ngày tải lên: 18/06/2014, 16:20
Báo cáo hóa học: "Programmed cell death-1 (PD-1) at the heart of heterologous prime-boost vaccines and regulation of CD8+ T cell immunity" doc
... strategy could then be matched with heterologous vectors that expand and/ or differentiate the primed cells to therapeutically useful effector T cells or, alternatively, with homologous boosting ... death-1 (PD-1) at the heart of heterologous prime-boost vaccines and regulation of CD8+ T cell immunity Journal of Translational Medicine 2010 8:132 Submit...
Ngày tải lên: 18/06/2014, 16:20
Báo cáo sinh học: "Differentiation associated regulation of microRNA expression in vivo in human CD8+ T cell subsets" doc
... upregulated during CD8+ T lymphocyte differentiation To investigate if defined microRNA profiles can be associated with CD8+ T cell differentiation status, the relative expression levels of the microRNAs ... preferentially during early memory differentiation Interestingly, not all members are regulated concomitantly, indicating a differential intra-cluster regulation in...
Ngày tải lên: 18/06/2014, 19:20
Báo cáo hóa học: " Impairment of the CD8+ T cell response in lungs following infection with human respiratory syncytial virus is specific to the anatomical site rather than the virus, antigen, or route of infection" pdf
... administered either by the IN or ID route IN inoculation of mice with the WR strain of VV has been shown to cause respiratory tract infection followed by dissemination of the virus to various visceral ... it is not the virus bearing the epitope nor local virus replication that results in the decreased functionality of CD8+ CTL in lungs, but...
Ngày tải lên: 20/06/2014, 01:20
báo cáo hóa học:" Differentiation associated regulation of microRNA expression in vivo in human CD8+ T cell subsets" pptx
... upregulated during CD8+ T lymphocyte differentiation To investigate if defined microRNA profiles can be associated with CD8+ T cell differentiation status, the relative expression levels of the microRNAs ... preferentially during early memory differentiation Interestingly, not all members are regulated concomitantly, indicating a differential intra-cluster regulation...
Ngày tải lên: 20/06/2014, 03:20
Báo cáo y học: "Recruitment of dendritic cells and macrophages during T cell-mediated synovial inflammation" doc
... Histopathology of arthritis induced in rats by active immunization to mycobacterial antigens or by systemic transfer of T lymphocyte lines A light and electron microscopic study of the articular ... which to study APCs during the effector phase of T cell-mediated autoimmunity Firstly, activated CD4+ T cells from central lymph of arthritic donors transfer the disease wi...
Ngày tải lên: 09/08/2014, 10:22
Báo cáo y học: "Apoptotic cell-mediated suppression of streptococcal cell wall-induced arthritis is associated with alteration of macrophage function and local regulatory T-cell increase: a potential cell-based therapy" ppsx
... use and care of live animals and were approved by the Animal Care and Use Committee of National Institute of Dental and Craniofacial Research Acute and chronic joint pathology was clinically monitored ... inflammation and autoimmune disease, and may also offer clues to manipulate Tregs and macrophages by apoptotic cell injection The data are in line with our previous...
Ngày tải lên: 09/08/2014, 14:22
Báo cáo y học: " Characteristics of CD8+ T cell subsets in Chinese patients with chronic HIV infection during initial ART" doc
... et al.: Characteristics of CD8+ T cell subsets in Chinese patients with chronic HIV infection during initial ART AIDS Research and Therapy 2011 8:15 Submit your next manuscript to BioMed Central ... However, little is known about the change of CD8+ cell subsets during early period of ART In this study we investigated the dynamic changes not only in...
Ngày tải lên: 10/08/2014, 05:22
Báo cáo y học: "Genome-wide analysis of primary CD4+ and CD8+ T cell transcriptomes shows evidence for a network of enriched pathways associated with HIV disease" pot
... member KLRD1L gtgggagaatggctctgc KLRD1R tttgtattaaaagtttcaaatgatgga BDLvsLTNP CD8 2.5 2.1 IRS2 NM_003749.2 insulin receptor substrate IRS2L tgacttcttgtcccaccactt IRS2R catcctggtgataaagccaga CD8 3.8 ... ACTA2L ctgttccagccatccttcat ACTA2R tcatgatgctgttgtaggtggt BDLvsVIR CD8 -1.3 -2.2 ATP6V1D NM_015994.2 ATPase, H+ transporting, lysosomal 34kDa, V1 subunit D ATP6V1DL ttttcactagctgaagccaagtt ATP6...
Ngày tải lên: 13/08/2014, 01:20
Báo cáo y học: "Escape is a more common mechanism than avidity reduction for evasion of CD8+ T cell responses in primary human" pdf
... when antigen is limiting, and they initiate target cell lysis better than lower avidity T cells at any given antigen density [23] In vitro studies also suggest that HIVspecific CD8+ T cells must ... recent study also reported a relationship between T cell avidity and polyfunctionality, finding that high avidity HIV-specific T cells are typically polyfunctional and...
Ngày tải lên: 13/08/2014, 01:20
Báo cáo y học: "Viral suppression of multiple escape mutants by de novo CD8+ T cell responses in a human immunodeficiency virus-1 Infected elite suppressor" ppt
... anything, decreased viral fitness further This may suggest that compensatory mutations exist in the plasma variants which partially rescue fitness defects caused by the TW10 mutations, but that these ... wild type NL43 with gag replaced by gag of the dominant proviral variant of the patient (Figure 2a) The dominant proviral variant of ES8 had no mutation in any HLA-B*57 restrict...
Ngày tải lên: 13/08/2014, 01:21