Proteome analyses of butyrate treated HCT 116 colorectal cancer cells

... The number of migrated cells treated with butyrate was expressed as a ratio of migrated control cells Figure 4.3: 1-D western blot of p21, c-Myc, and p53 on mM, 24 hr butyrate- 69 treated (Trt) ... migrated treated cells are expressed as a ratio of corresponding control cells without butyrate treatment 11 INDEX OF ABBREVIATIONS 1-D One-dimensional 2-DE Two-dimensi...

Ngày tải lên: 15/09/2015, 22:42

... death This supports the association of the protective effects of butyrate with its biochemical effects on the mitochondria of cancer cells viii In particular, one of the mitochondrial proteins ... Enrichment of mortalin isoforms and presence of additional isoforms in HCT 116 mitochondrial fraction, relative to whole cell lysate 82 3.12 Butyrate effects...

Ngày tải lên: 26/11/2015, 12:25

... question of detecting therapy-related changes in the mass profiles registered for blood samples collected from breast cancer patients SELDI-ToF analysis of the plasma proteome of breast cancer patients ... Pietrowska et al., Mass spectrometry-based analysis of therapy-related changes in serum proteome patterns of patients with earlystage br...

Ngày tải lên: 18/06/2014, 16:20

... investigation of dispositional optimism as a predictor of health-related quality of life in head and neck cancer patients Qual Life Res 2000, 9:951-960 Schultz AA, Winstead-Fry P: Predictors of quality of ... these two predictors The measures of perceived quality of care (problems with Treatment Information, control of pain/discomfort, control of nausea...

Ngày tải lên: 18/06/2014, 19:20

... Caco-2 cells (Figure 4A) CXC receptor-4 gene silencing abrogates migration of colorectal cancer cells To analyze if the chemotactic effect of CXCL12 on the migration of HT-29 and SW480 cells ... rate of colorectal cancer cells after CXCR4 blockage by mRNA silencing and inhibition antibodies CXCR4 blockage by mRNA silencing or anti-CXCR4 antibodies might res...

Ngày tải lên: 20/06/2014, 03:20

... Adenovirus-mediated siRNA targeting Bcl-xL inhibits proliferation, reduces invasion and enhances radiosensitivity of human colorectal cancer cells Jinsong Yang1, 2, Ming Sun2, ... prognosis of colorectal cancer (CRC) patients The aim of this study was to investigate the association of Bcl-xL expression with invasion and radiosensitivity of huma...

Ngày tải lên: 09/08/2014, 02:21

... REFERENCES 67 iv SUMMARY Background: Approximately 10-30% of colorectal cancers are characterized with distinctly high densities of tumour- infiltrating lymphocytes (TILS), including ... affect the clinical phenotype of tumours Indeed, one of the most reproducible findings in prognostic studies has been that a high density of tumourinfiltrating lymphocytes (TILS) is ass...

Ngày tải lên: 03/10/2015, 20:57

... orientation in the Construction of cell clones Metabolic labelling and carbohydrate analysis BxPC3 cells and T5AS clone (4.0 · 106 cells) were plated in 25-mm2 flasks containing 0.2 mCi [3H]Gal (Amersham ... as are the original BxPC3 cells (Fig 2C) A relevant amount Fig Characterization of T5AS clone A cell clone expressing a b3Gal-T5 antisense construct (T5AS) was obt...

Ngày tải lên: 19/02/2014, 12:20

... results obtained indicated that mature miR-143 enhanced sensitivity to 5-FU Indeed, cell viability was reduced and cell death was increased in HCT116- OV3 compared to parental and HCT116- EM1 cells, ... growth and ⁄ or escape from apoptosis In addition, miR-143 expression has been shown to increase after a-mangostin exposure in human colon cancer DLD-1 cells, res...

Ngày tải lên: 07/03/2014, 00:20

... CTCATGCTTCTTTCAACAGTGG 82 F: CCATACCTCAAGTATTTGCCATC 67 R: TCCAGTCTTTCGTATTAATGATTCAG F: CATGGTGCACTTTCCTCCTT Cyclin B2 NM004701 F: GCATTATCATCCTTCTAAGGTAGCA (CCNB2) a R: TGTAATACTGCTGCTTTAAGTTCCA ... gene, KIAA0247, in human gastrointestinal tissues and colonic cell lines Results indicated that KIAA0247 ubiquitously expresses in gastrointestinal tissues and in Huang et al Journal...

Ngày tải lên: 18/06/2014, 19:20

... CTCATGCTTCTTTCAACAGTGG 82 F: CCATACCTCAAGTATTTGCCATC 67 R: TCCAGTCTTTCGTATTAATGATTCAG F: CATGGTGCACTTTCCTCCTT Cyclin B2 NM004701 F: GCATTATCATCCTTCTAAGGTAGCA (CCNB2) a R: TGTAATACTGCTGCTTTAAGTTCCA ... gene, KIAA0247, in human gastrointestinal tissues and colonic cell lines Results indicated that KIAA0247 ubiquitously expresses in gastrointestinal tissues and in Huang et al Journal...

Ngày tải lên: 20/06/2014, 03:20

... 10.1186/1477-7819-8-31 Cite this article as: Zheng et al., The conformation change of Bcl-2 is involved in arsenic trioxide-induced apoptosis and inhibition of proliferation in SGC7901 human gastric cancer cells ... at determining whether arsenic trioxide inhibits proliferation and induces apoptosis in SGC7901 human gastric cancer cells,...

Ngày tải lên: 09/08/2014, 03:21

... Up-regulation of XAF1 mRNA and protein by somatostatin and Octreotide in prostate cancer cell lines To examine the regulatory effects of somatostatin and Octreotide on XAF1 mRNA and protein expression, ... somatostatin and Octreotide on XAF1 expression in prostate cancer cell lines We found that somatostatin and Octreotide up-regulated XAF...

Ngày tải lên: 10/08/2014, 10:20

... information with caution as most of the proposed mechanisms are based on in vitro The uptake and subsequent actions of β-glucan on immune cells Figure The uptake and subsequent actions of β-glucan on ... http://www.jhoonline.org/content/2/1/25 β-glucan1 is one of the key components of the fungal cell wall Figure β-glucan is one of the key components of the fun...

Ngày tải lên: 10/08/2014, 22:20