Tight junctions and adherens junctions quantifying adhesion and role in mechanotransduction in epithelial cells
... cells lining the alveoli in the lungs are stretched during inspiration, and epithelial cells lining the gastrointestinal tract and renal tract undergo mechanical strain during peristalsis Cells ... external stimuli, in particular mechanical stimuli, on endothelial cells lining blood vessels and epithelial cells lining the respiratory, gastrointestinal and urinary tra...
Ngày tải lên: 11/09/2015, 09:04
... Claudin- 4 Claudin- 18a Claudin- 3 Claudin- 18b Claudin- 20 Claudin- 12 Claudin- 14 Claudin- 2 Claudin- 19b Claudin- 19a Claudin- 16 Claudin- 7 Claudin- 1 Claudin- 21 Claudin- 24 Claudin- 22 Claudin- 23 Figure A phylogenetic ... Nag and Morin: Genome Biology 2009, 10:235 235.4 Claudin- 10a Claudin- 8 Claudin- 17 Claudin- 5 ‘Classic’ claudins ‘Non-classic’ claudins Clau...
Ngày tải lên: 14/08/2014, 21:20
... Fig ATP-binding domain of HSP70 is essential for the inhibition of H2O2-induced activation of caspases-9 and -3 and apoptosis (A) The effects of HSP70 and its deletion mutant proteins on the ... activation Such a mechanism is independent of the interaction of HSP70 with Smac but requires the ATP-binding domain of the protein However,...
Ngày tải lên: 16/03/2014, 01:20
Báo cáo khoa học: Sustained activation of ERK1/2 by NGF induces microRNA-221 and 222 in PC12 cells pdf
... sustained activation of ERK1 ⁄ by NGF, but not the transient activation of ERK, could effectively induce miR221 and 222 in PC12 cells Finally we identified the BH3-only protein Bim, which is involved ... involved in NGF- dependent neuronal survival [17–19], as a potential target of miR-221 and 222 Results NGF stimulation induces miR-221 /222 in PC12 ce...
Ngày tải lên: 16/03/2014, 01:20
Báo cáo khoa học: Poneratoxin, a neurotoxin from ant venom Structure and expression in insect cells and construction of a bio-insecticide pot
... end of a signal peptide: 5¢-CAGAAGCGGAA GAAAGCATGCAAAGGCAGA-3¢ (number 2), were used In the second PCR the plasmid pFastBacPx was used as a template with upstream and downstream primers containing, ... the N-terminal fragment of the poneratoxin gene Two others: forward 5¢-GCC GCCCGTGATACAGGCGATCCACGATGCGCAGA GGTAGTAATGAG-3¢ and reverse 5¢-AATTCTCATTA CTACCTCTGCGCATCGTGGATCGCCTGT...
Ngày tải lên: 30/03/2014, 13:20
Báo cáo sinh học: " Open Access Cloning of the canine RNA polymerase I promoter and establishment of reverse genetics for influenza A and B in MDCK cells" docx
... http://www.virologyj.com/content/4/1/102 A < /b> HindIII XbaI BamHI BamHI BamHI AvrII SpeI EcoRI SpeI HindIII SphI XbaI XbaI BamHI * XbaI BamHI BamHI SacI BamHI * EcoRI BamHI SacI BamHI BamHI AvrII 18S rRNA Gene MDCK Eco RI 7.1 kb Fragment ... influenza < /b> using the < /b> RNA < /b> pol I < /b> transcription machinery in canine < /b> cells, cloning < /b> the < /b> canine < /b>...
Ngày tải lên: 18/06/2014, 18:20
Báo cáo hóa học: " Cloning of the canine RNA polymerase I promoter and establishment of reverse genetics for influenza A and B in MDCK cells" pdf
... http://www.virologyj.com/content/4/1/102 A < /b> HindIII XbaI BamHI BamHI BamHI AvrII SpeI EcoRI SpeI HindIII SphI XbaI XbaI BamHI * XbaI BamHI BamHI SacI BamHI * EcoRI BamHI SacI BamHI BamHI AvrII 18S rRNA Gene MDCK Eco RI 7.1 kb Fragment ... influenza < /b> using the < /b> RNA < /b> pol I < /b> transcription machinery in canine < /b> cells, cloning < /b> the < /b> canine < /b>...
Ngày tải lên: 20/06/2014, 01:20
Báo cáo y học: "Coaggregation of Fc RI with Fc RIIB Inhibits Degranulation but Not Induction of Bcl-2 Family Members A1 and Bim in Mast Cells" ppsx
... Phosphorylation of Akt Is Attenuated by Coaggregation of Fc RI with Fc RIIB Coaggregation of Fc RI with Fc RIIB Inhibits IgE-Dependent Mast- Cell Degranulation To analyze the effect of Fc RIIB- mediated ... proteins.17 Acknowledgements Figure Schematic diagram showing the effect of coengagement of Fc RI with Fc RIIB Coaggregation of Fc RI with Fc RII...
Ngày tải lên: 08/08/2014, 21:20
Báo cáo y học: "Coexpression and interaction of CXCL10 and CD26 in mesenchymal cells by synergising inflammatory cytokines: CXCL8 and CXCL10 are discriminative markers for autoimmune arthropathie" doc
... Declaration of Helsinki The Ethical Committee of the University of Leuven approved the study Results Synergistic induction of CXCL10 ligands in fibroblasts and endothelial cells by inflammatory cytokines ... CXCL8 and CXCL10 induction in fibroblasts by IL-1β and interferons CXCL8 and CXCL10 induction in fibroblasts by IL-1β and interferons Confluent...
Ngày tải lên: 09/08/2014, 08:22
Báo cáo khoa học: "Increased betulinic acid induced cytotoxicity and radiosensitivity in glioma cells under hypoxic conditions" pptx
... al.: Increased betulinic acid induced cytotoxicity and radiosensitivity in glioma cells under hypoxic conditions Radiation Oncology 2011 6:111 Submit your next manuscript to BioMed Central and ... protein expression and radiosensitivity in U251MG and U343MG glioma cell lines under normoxic and hypoxic conditions were determined With higher concentration...
Ngày tải lên: 09/08/2014, 09:21
báo cáo khoa học: "Adenovirus-mediated delivery of bFGF small interfering RNA reduces STAT3 phosphorylation and induces the depolarization of mitochondria and apoptosis in glioma cells U251" pdf
... of bFGF small interfering RNA reduces STAT3 phosphorylation and induces the depolarization of mitochondria and apoptosis in glioma cells U251 Journal of Experimental & Clinical Cancer Research ... on the effects of inhibiting bFGF expression on the JAK2 -STAT3 pathway in glioma Our results showed the down-regulation of bFGF inhibits...
Ngày tải lên: 10/08/2014, 10:21
báo cáo khoa học: " Identification and characterization of flowering genes in kiwifruit: sequence conservation and role in kiwifruit flower development" ppt
... Page of 15 Figure Expression profiles of Actinidia flowering genes in mature plant organs Real-time RT-PCR analysis of the Actinidia flowering genes in the root, stem internode, leaf, flower and ... Figure Expression profiles of Actinidia flowering genes in normal and aberrant flowers Real-time RT-PCR analysis of the Actinidia flowering genes in the lea...
Ngày tải lên: 11/08/2014, 11:22
Báo cáo y học: " Effect of neutrophil elastase and its inhibitor EPI-hNE4 on transepithelial sodium transport across normal and cystic fibrosis human nasal epithelial cells" pot
... Prulière-Escabasse et al.: Effect of neutrophil elastase and its inhibitor EPI-hNE4 on transepithelial sodium transport across normal and cystic fibrosis human nasal epithelial cells Respiratory Research 2010 ... specific and potent inhibitor of hNE [22], could block this stimulation The objectives of the study were therefore to test the effects...
Ngày tải lên: 12/08/2014, 11:22
Báo cáo y học: " Some ABCA3 mutations elevate ER stress and initiate apoptosis of lung epithelial cells" pptx
... in the ER, caused significant increase of the ER stress and early and late apoptosis markers in the A549 cells (Figure 4, and 6) The ER stress caused by R280C mutation was slightly lower and surface ... as: Weichert et al.: Some ABCA3 mutations elevate ER stress and initiate apoptosis of lung epithelial cells Respiratory Research 2011 12:4 Submit y...
Ngày tải lên: 12/08/2014, 13:22