Understanding dentine demineralizaion and development of strategies for biomimetic remineralization of deminderalized dentine

... Different zones of dentine caries 15 2.2.4 Different methods for induction of artificial dentine caries 16 2.3 Remineralization of dentine 18 2.3.1 The role of inorganic matrix of dentine in remineralization ... Demineralization of dentine The characterization of changes in the inorganic phase and organic matrix of dentine is important to understand the pri...

Ngày tải lên: 10/09/2015, 15:53

... the theme: Formulating strategies for retail banking business of Joint Stock Commercial Bank for Investment and Development of Vietnam during the period 2013 - 2017 with the desire to apply ... for further development of the bank' s retail banking activities Subject and scope of the research: - Subject: Retail Activities at the...

Ngày tải lên: 26/03/2015, 10:58

... used for RT-PCR were: for the I7 OR (5¢-CGTCAAGGAGAAAAAACCCCGGATCT AAAAAATGGAGCGAAGGAACCACAG-3¢) and (5¢-AG CTGCCTGCAGGTCGACTCTAGAGGATCCTAACCAA TTTTGCTGCC-3¢); for OR17-40 (5¢-CGTCAAGGAG AAAAAACCCCGGATCTAAAAAATGGAGCAGAAAC ... recombination introducing the c-myc-OR17-40 coding sequence, using primers (5¢-CGTCAAGGAGAAAAAAC CCCGGATCTAAAAAATGGAGCAGAAACTCATCTC TGAAGAGGATCTG-3¢) and (5¢-G...

Ngày tải lên: 07/03/2014, 16:20

... recovery and plasticity with brain stimulation? One of the contemporary methods under investigation as a tool to promote neuroplasticity is non-invasive brain stimulation The concept of treating ... This was based on the understanding of neurological dysfunction at the time, and the observation that patients appeared to tolerate and benefit from physical inte...

Ngày tải lên: 19/06/2014, 08:20

... Antibody response to five recombinant antigens and sero -diagnosis with 35 kDa for M avium subsp paratuberculosis 113 Dialysis of proteins and removal of endotoxins The recombinant proteins were ... IS900 PCR test) in Western blot (Fig 1) Serological evaluation of recombinant antigens Antibody responses to all recombinant antigens positively in...

Ngày tải lên: 07/08/2014, 17:22

... found obesity to be a significant risk factor for AHR at all levels of obesity for females but only for higher levels of obesity for men.11,21,22 Discussion We found obesity to be a significant risk ... increased airways resistance and methacholine reactivity Therefore, obese patients complain of more dyspnea and asthma-like symptoms than leaner patients and...

Ngày tải lên: 08/08/2014, 21:20

... accordance of all but points seem quite acceptable APPLICATIONS TO SIMULATION Mitchell (1975a) gave a detailed diagram of the processes involved in the growth and development of a tree in a stand ,and Inose ... for Tree and Stand Simulation (Fries J, eds) Dept For Yield Res, R Coll For, Stockholm, Res Notes 30, 223-239 Hegyi (1974) A simulation model for mana...

Ngày tải lên: 08/08/2014, 23:22

... results of this study The finding of a major gene affecting fat androstenone level gives rise to new prospects for reducing incidence of boar taint by means of breeding The average level of individuals ... FJ35 and FJ39) For investigating the linkage of SLA with the postulated major genes, the number of informative meioses was 441 typing was performed Statisti...

Ngày tải lên: 09/08/2014, 18:22

... responsibilities of non-physicians changed) See Table for a list of provider- focused and workflow-focused implementation strategies A count variable was computed for number of provider- focused implementation ... account for general dislike for CPGs and still test for differences among Table 2: Operationalization of provider- focused and workflow-focused...

Ngày tải lên: 11/08/2014, 05:21

... still test for differences among Table 2: Operationalization of provider- focused and workflow-focused implementation strategies used in the study Provider- focused implementation strategies Workflow-focused ... related providers' reports of the number of implementation strategies within each class (provider- and workflow-focused) to their acceptance of...

Ngày tải lên: 11/08/2014, 16:20

... antibody responses elicited by infection and immunization Discussion The primary objectives of the present study were to characterize the antibody response elicited by infection with XMRV and to ... present at days 42 and 134 and were boosted by re -infection (day 167) Anti-p30 reactivity was barely detectable at day 42 and 134 and was substantially boosted post...

Ngày tải lên: 13/08/2014, 01:20

... history of low back pain: part I: development of a reliable and sensitive measure of disability in low- back pain Spine 1983, 8:141-144 Kirkaldy-Willis WH, Bernard TN: Managing low back pain 4th ... prescribed naprosyn, diazepam and hydrocodone/acetaminofen for pain control, confined to quarters to rest and imaging was obtained The pain worsened, resultin...

Ngày tải lên: 13/08/2014, 14:20

... several banks in Vietnam have concentrated on developing card services and payment cards on POS Bank for Investment and Development of Viet Nam (BIDV) is one of the banks which pay attention to ... regulations 36 CHAPTER CURRENT SITUATION OF PAYMENT CARD SERVICE ON POS IN BANK FOR INVESTMENT AND DEVELOPMENT OF VIETNAM 3.1 Introduction of...

Ngày tải lên: 05/10/2014, 06:51

... on retail banking services 1.1.1 Definition of retail banking services In the open economy, the demand on banking services is increasingly high, especially for the retail banking services The ... considered and selected the thesis subject Improving the quality of retail banking services in Bank for Investment and Development of...

Ngày tải lên: 06/10/2014, 06:36

... activities of study and evaluating the growth and development of some taro varieties on single-crop-land and lowland in Yen Bai province, finding out the most potential and suitable variety for the ... implemented the study titled "Research on the growth and development of taro varieties and cultivation techniques for the...

Ngày tải lên: 06/10/2014, 11:46