Investigations of carbon nanotube based electronic devices with focus on metal and carbon nanotube contacts

... Atomic structure of carbon nanotube and metal contacts 1.2.1.1 Carbon nanotube and metal contact with side-contact structure 1.2.1.2 Carbon nanotube and metal contact with end-contact structure ... INVESTIGATIONS OF CARBON NANOTUBE BASED ELECTRONIC DEVICES WITH FOCUS ON METAL AND CARBON NANOTUBE CONTACTS HUANG LEIHUA (B Sci (Hons.)...

Ngày tải lên: 10/09/2015, 15:52

... anglebased user selection (AUS), opportunistic norm-based user selection (NUS), and random user selection (RUS) 3.1 Semiorthogonal User Selection (SUS) One way to ease the beamforming optimization is ... is, the angle between the channels, is considered, the user selection method simply chooses the strongest user first and then selects other users one by one...

Ngày tải lên: 21/06/2014, 20:20

... waves and orthographic forms to which we assign meaning on the basis of our past experience with them and on the basis of the situations in which these waves and forms are used Discourse analysis ... canals, or the English language having a nice cup of tea, or the German language racing madly along the autobahn You only find discourse.” Robert de Beaugrande (1997: 36)...

Ngày tải lên: 10/08/2015, 19:47

... 1) Investigation of the material properties and physical parameters of Co/Pd based spinvalves and MTJs with perpendicular anisotropy a Understand the effects of perpendicular anisotropy on the ... coupling and coercivity b Control of perpendicular anisotropy and coercivity of Co/Pd multilayers and spinvalves c Optimization of the spin- valve and MT...

Ngày tải lên: 10/09/2015, 15:53

... AN EXPERIMENTAL STUDY OF VIDEO UPLOADING FROM MOBILE DEVICES WITH HTTP STREAMING CUI WEIWEI (B.Sc., Harbin Institute of Technology, China) A THESIS SUBMITTED FOR THE DEGREE OF MASTER OF SCIENCE ... Smooth Streaming and can also be stored as several large files in HDS From the comparison of different HTTP streaming solutions, we can see that the DASH stand...

Ngày tải lên: 28/09/2015, 13:28

... Electron Transport Study of Two- terminal Molecular Electronic Devices Using Ab Initio Methods Zou Xu (B Eng., University of Science and Technology of China, P R China) A ... of microelectronic devices As a result, molecular electronic systems built with molecular electronic devices could be miniaturized continuously The first step to the success of...

Ngày tải lên: 05/10/2015, 19:03

... GCGGGATCCCTCAGCCCATTGGAAGGCACC ATAAGAATGCGGCCGCTCAGCTGTCACTCAGCCGCAGCAG GCGGGATCCAACAAGGAAGAACCCCCC ATAAGAATGCGGCCGCTCAGTCTGAGGTGATAACATTCCC GCGGGATCCCTGGACGGGCAGCCGATGAAG ATAAGAATGCGGCCGCTCAAAGCTTGATTTTGAATTCTGT ... GCGGGATCCAACAAGGAAGAACCCCCC ATAAGAATGCGGCCGCTCAAGGCAGCTCGCTCTCCTTTTT GCGGGATCCCTCAGCCCATTGGAAGGCACC ATAAGAATGCGGCCGCTCAAGGCAGCTCGCTCTCCTTTTT GCGGGATCCGTGAATAATCTGCACCCTCGA ATAAGA...

Ngày tải lên: 19/02/2014, 05:20

... transfected into 29 3 cells and expression was GST, GST-TFIIS, GST-MCM2(169 21 2)wt, GSTMCM2(169 21 2)L192P/R193G, and GST-MCM2(169– 21 2)V203E/F204L proteins were expressed in BL21(LysS)DE3 cells and coupled ... ligand, TFIIS [5,6] This data is consistent with the idea that amino acids 169 21 2 of MCM2 are binding to some component(s) of RNA polymerase II holoenzyme Fig...

Ngày tải lên: 17/03/2014, 10:20

... AL.: DEGRADATION OF BACTERIA ESCHERICHIA COLI EXPERIMENTAL 2.1 Sample preparation Bacteria Escherichia coli (E coli) were cultivated according to the standard procedure In experiment we used bacteria ... The source of Ar ions is a commercial ion gun used for sputtering of materials during depth profiling Ar ion beam with the energy of keV at an incidence a...

Ngày tải lên: 18/05/2014, 20:33

... administration, the ability to migrate to sites of T cell activation and generation of CTLs Activated and mature DCs results in antigen-specific immunity, while fully immature and inactivated ... class I hTERT pulsed DCs Vaccinations with DCT and DCTI in 10 patients Both vaccines (DCT and DCTI) were equivalent in eliciting CD8 +T cell responses and there were...

Ngày tải lên: 18/06/2014, 15:20

... theory of integral equations and their relation with boundaryvalue problems, we refer to the book of Corduneanu 22 and Agarwal and O’Regan 23 On the other hand, boundary- value problems with integral ... paper, we consider the existence of positive solutions for a class of boundary value problems with integral boundary conditions of fourth-order imp...

Ngày tải lên: 21/06/2014, 16:20

... merocoenosis of cambioxylophagous insect fauna associated with stems of standing spruce trees attacked by bark beetles, in the merocoenosis of trees affected by fungal tree pathogens, lightning and wind-felling, ... richness and diversity of cambioxylophagous and wood-inhabiting insects (33), but only 18 species were more abundant Considering the frequency of...

Ngày tải lên: 07/08/2014, 10:21

... 1.5% CLA produced no adverse consequences in the animals Effects of Combination Dietary Conjugated Linoleic Acid with Vitamin A (Retinol) and Selenium on the Response of the Immunoglobulin Production ... collection, the end of the duodenum and the cranial part of the cecum were tied and both ends were cut One end of the small inte...

Ngày tải lên: 07/08/2014, 17:22

... TDR, also obtained a higher bias with higher q values Finally, Salas Comparison between neutron probe and TDR Table III Summary of the ANOVA results (two-way ANOVA with paired-values): (a) Probe ... be also explained (at least partially) in terms of the strong spatial variation in q measurements in the upper soil layers (the same point of the soil is not measu...

Ngày tải lên: 08/08/2014, 01:21

... lines In addition, propranolol showed a synergism of growth inhibition in combination with irradiation in SGC-7901 and BGC-823 cells On the contrary, isoproterenol demonstrates anti-irradiation ... Effects of propranolol in combination with radiation on apoptosis and survival of gastric cancer cells in vitro Radiation Oncology 2010 5:98 Subm...

Ngày tải lên: 09/08/2014, 09:20