ocial integration and its association with mortality among older people in china

ocial integration and its association with mortality among older people in china

ocial integration and its association with mortality among older people in china

... Examining the association between social integration and mortality for older people in contemporary China The aim of this thesis is to examine the association between social integration and mortality ... older people in China 2.3 Social and cultural differences in the association between social integration and health for older adults Although the inc...
Ngày tải lên : 10/09/2015, 15:52
  • 317
  • 529
  • 0
báo cáo hóa học: " Biomarkers of oxidative stress and its association with the urinary reducing capacity in bus maintenance workers" pptx

báo cáo hóa học: " Biomarkers of oxidative stress and its association with the urinary reducing capacity in bus maintenance workers" pptx

... article as: Sauvain et al.: Biomarkers of oxidative stress and its association with the urinary reducing capacity in bus maintenance workers Journal of Occupational Medicine and Toxicology 2011 ... verified by testing the correlation between levels of 8OHdG, reflecting oxidative stress, and the reducing capacity (corresponding to a defense agai...
Ngày tải lên : 20/06/2014, 00:20
  • 13
  • 483
  • 0
báo cáo sinh học:" Alexithymia and its association with burnout, depression and family support among Greek nursing staff" docx

báo cáo sinh học:" Alexithymia and its association with burnout, depression and family support among Greek nursing staff" docx

... 2) Alexithymia was correlated positively with depression, emotional exhaustion and depersonalization and negatively with sense of family support and personal achievement (Table 3) Family support ... tried to interpret the associations of alexithymia with professional burnout, depressive symptoms and family support Alexithymia was directly associated with...
Ngày tải lên : 18/06/2014, 17:20
  • 6
  • 451
  • 0
Báo cáo y học: "Psychological quality of life and its association with academic employability skills among newlyregistered students from three European faculties" ppt

Báo cáo y học: "Psychological quality of life and its association with academic employability skills among newlyregistered students from three European faculties" ppt

... al.: Psychological quality of life and its association with academic employability skills among newly-registered students from three European faculties BMC Psychiatry 2011 11:63 Submit your next ... study improves our understanding of the associations between the psychological quality of life, the social and environmental contexts, and the acquisition...
Ngày tải lên : 11/08/2014, 15:22
  • 10
  • 432
  • 0
Báo cáo y học: "Epidemiological manifestations of hepatitis C virus genotypes and its association with potential risk factors among Libyan patients" pps

Báo cáo y học: "Epidemiological manifestations of hepatitis C virus genotypes and its association with potential risk factors among Libyan patients" pps

... epidemiology of HCV genotypes among different Libyan patients and its association with the risk factors involved and how this could be reflected on the prevention of such virus among the Libyan society ... parts of the country to estimate the diversity of HCV genotypes in each region and assess the risk factors involved with specific emphases on the...
Ngày tải lên : 12/08/2014, 02:20
  • 7
  • 257
  • 0
Báo cáo y học: "Walking for leisure among adults from three Brazilian cities and its association with perceived environment attributes and personal factors" pot

Báo cáo y học: "Walking for leisure among adults from three Brazilian cities and its association with perceived environment attributes and personal factors" pot

... Walking for leisure among adults from three Brazilian cities and its association with perceived environment attributes and personal factors Grace A O Gomes1, Rodrigo ... and little is known about walking patterns and its association with environmental features in low and middle income countries Objectives: To describe walking for leisure and...
Ngày tải lên : 14/08/2014, 08:21
  • 20
  • 183
  • 0
báo cáo hóa học:" BMP-2 signaling in ovarian cancer and its association with poor prognosis" pot

báo cáo hóa học:" BMP-2 signaling in ovarian cancer and its association with poor prognosis" pot

... activates SMAD 1/5/8 and Erk MAPKs in ovarian cancer cell lines To investigate the role of BMP-2 in ovarian cancer cells we selected three cell lines, TOV-2223, TOV-1946 and TOV112D, for in vitro assays ... cells of many origins including cancers arising from thyroid, androgen-dependent prostate in presence of androgen, myeloma, gastric and pancreatic cells [14,18-22]...
Ngày tải lên : 20/06/2014, 07:20
  • 11
  • 406
  • 0
Báo cáo y học: "Prevalence of alexithymia and its association with anxiety and depression in a sample of Greek chronic obstructive pulmonary disease (COPD) outpatients" pptx

Báo cáo y học: "Prevalence of alexithymia and its association with anxiety and depression in a sample of Greek chronic obstructive pulmonary disease (COPD) outpatients" pptx

... [15], as well the reported associations among depression, anxiety, somatic symptoms and alexithymia [27], we studied the prevalence of alexithymia and its association with anxiety and depression in ... emotions [20-22] Although the role of alexithymia and its association with levels of anxiety and depression has already been recognised in other...
Ngày tải lên : 08/08/2014, 23:21
  • 7
  • 436
  • 0
Báo cáo y học: " Mitochondrial targeting of human NADH dehydrogenase (ubiquinone) flavoprotein 2 (NDUFV2) and its association with early-onset hypertrophic cardiomyopathy and encephalopathy" ppt

Báo cáo y học: " Mitochondrial targeting of human NADH dehydrogenase (ubiquinone) flavoprotein 2 (NDUFV2) and its association with early-onset hypertrophic cardiomyopathy and encephalopathy" ppt

... targeting of human NADH dehydrogenase (ubiquinone) flavoprotein (NDUFV2) and its association with early-onset hypertrophic cardiomyopathy and encephalopathy Journal of Biomedical Science 20 11 18 :29 ... mislocalization of NDUFV2 caused by the IVS2+5_+8delGTAA mutation in NDUFV2 gene is associated with early-onset hypertrophic cardiomyopathy a...
Ngày tải lên : 10/08/2014, 05:21
  • 17
  • 434
  • 0
Báo cáo y học: "Prevalence of endotoxemia after surgery and its association with ICU length of stay" potx

Báo cáo y học: "Prevalence of endotoxemia after surgery and its association with ICU length of stay" potx

... Other Time ICU Hosp Alive Late 20 Y Late Y Contaminants Late Y Pseudomonas Late 24 26 Y S epidermidis Early 12 Y S aureus Early 12 Y Early 32 Y Early 19 Y Early Y Early 19 Y Pseudomonas Early 28 - ... detection Length of stay and mortality of both ICU and hospital were calculated Clinicians were unaware of the results of the EA assay throughout patient's...
Ngày tải lên : 13/08/2014, 16:21
  • 8
  • 298
  • 0
THE STUDY OF a NOVEL MIXED LINEAGE LEUKEMIA 5 ISOFORM AND ITS ASSOCIATION WITH HUMAN PAPILLOMAVIRUS 16 18   RELATED HUMAN CERVICAL CANCERS

THE STUDY OF a NOVEL MIXED LINEAGE LEUKEMIA 5 ISOFORM AND ITS ASSOCIATION WITH HUMAN PAPILLOMAVIRUS 16 18 RELATED HUMAN CERVICAL CANCERS

... CGCGGATCCAATGGACTACAAAGACGATGAC GACAAGAGCATAGTGATCCCA MLL5β M5b_NotI.rev AAGGAAAAAAGCGGCCGCCAATATACGCGA GACTAGTCTT GFPMLL5β M5b_SalI.for ACGCGTCGACATGAGCATAGTGATCCCATTG M5b_BamHI.rev CGCGGATCCCAATATACGCGAGACTAGTCTT ... HPV18_7239.rev ACAACAACAACCATACATACC HPV18_ 7168 .for TGTTGTGTTTGTATGTCCTGT HPV18_7 350 .rev CCACAAACACAAATACAGTTGTT HPV18_7378.for TATTGTCCTGTATTTCAAGTTAT HPV18_ 757 6.rev CGC...
Ngày tải lên : 02/10/2015, 17:15
  • 140
  • 396
  • 0
báo cáo khoa học: "Characterization of Sucrose transporter alleles and their association with seed yield-related traits in Brassica napus" potx

báo cáo khoa học: "Characterization of Sucrose transporter alleles and their association with seed yield-related traits in Brassica napus" potx

... Characterization of Sucrose transporter alleles and their association with seed yield–related traits in Brassica napus L Fupeng Li, Chaozhi Ma§, Xia Wang, Changbin Gao, Jianfeng Zhang, ... (Table 3), indicating that an increase in any of the EFB, SP, or SS traits can increase seed yield The panel lines evaluated for yield-related traits were mostly modern c...
Ngày tải lên : 11/08/2014, 11:21
  • 47
  • 405
  • 0
Báo cáo y học: " The diagnostic value of serum leptin monitoring and its correlation with tumor necrosis factor-a in critically ill patients: a prospective observational study" ppt

Báo cáo y học: " The diagnostic value of serum leptin monitoring and its correlation with tumor necrosis factor-a in critically ill patients: a prospective observational study" ppt

... potassium, calcium, aspartate aminotransferase, alanine aminotransferase, prothrombin time, albumin, CRP, leptin, IL-6 and TNF -a) and arterial blood gas analysis Routine cultures of blood, urine and ... manifestations of SIRS and those with sepsis in patients suffering from a broad range of diseases in ICU and its correlation with other biomarkers Materials an...
Ngày tải lên : 13/08/2014, 20:21
  • 9
  • 306
  • 0
Characterizing iris surface features and their association with angle closure related traits in asian eyes

Characterizing iris surface features and their association with angle closure related traits in asian eyes

... of angle- closure disease in Asians1 and the involvement of iris in angle- closure diseases.2-6 In view of the lack of an iris grading system tailored for Asian eyes, we developed an iris grading ... to assess iris surface features from slit lamp photographs of Asian eyes Using this grading system, we found that eyes with more iris crypts had thinner ir...
Ngày tải lên : 30/09/2015, 10:11
  • 72
  • 231
  • 0
báo cáo hóa học: "Co-activation: its association with weakness and specific neurological pathology" pptx

báo cáo hóa học: "Co-activation: its association with weakness and specific neurological pathology" pptx

... Journal of NeuroEngineering and Rehabilitation 2006, 3:26 Authors' contributions RVD and CMW conceived of the study, and participated in its design and coordination and helped to draft the manuscript ... inclusion criteria for the subjects with neurological deficits ('neurology patients') were that the individual: a) had a condition causing lower limb weakness or perceived...
Ngày tải lên : 19/06/2014, 10:20
  • 8
  • 482
  • 0