Electrochemical detection of dengue virus using nanoporous membrane

... sensing for the detection of Dengue virus 72 iv Table of Contents 3.3.3 Binding affinity studies of the 2H2 antibody with Dengue and Dengue viruses 76 3.3.4 Effect of the membrane' s ... electrode CHIKV Chikungunya virus CPE Constant phase element DENV Dengue serotype virus DENV Dengue serotype virus DENV Dengue serotype virus DENV Dengue serotype virus D...

Ngày tải lên: 10/09/2015, 09:11

... NH2–CCATCTTTACCAGACAGTGTTA 3′ 3′ GGUAGAAAUGGUCUGUCACAAU 5′ 3′ UUGUGACUAAAGUUUACCACGAU 5′ 3′AGUAUC GGGACAUGUUACGACGA 5′ 166 H.V Tran et al / Biosensors and Bioelectronics 49 (2013) 164–169 2.5 Grafting ... formats (Xu et al., 2004, 2006; Cai et al., 2003) In this paper, we describe a label- free and reagentless miRNA sensor based on an interpenetrated network of carbon nanotube...

Ngày tải lên: 02/07/2014, 14:14

... Detection of dengue-4 virus in pune, western india after an absence of 30 years - its association with two severe cases Virology Journal 2011 8:46 Acknowledgements The authors wish to thank the Indian ... representing viruses from A) China and Philippines, B) Malaysia and Thailand and C), India and Sri Lanka suggesting the presence of clades withi...

Ngày tải lên: 11/08/2014, 21:22

... as: Ang et al.: Small interference RNA profiling reveals the essential role of human membrane trafficking genes in mediating the infectious entry of dengue virus Virology Journal 2010 7:24 Submit ... essential for mediating the infectious entry process of DENV into cells siRNA profiling of human membrane trafficking genes required...

Ngày tải lên: 12/08/2014, 04:21

... screening all serotypes of DENV sequentially using a human non -dengue immunized phage display library (Humanxy library) and to convert the Fab fragments isolated into full-length human IgG1 in a mammalian ... human phage library such as the Humanyx Fab phage display library was constructed by amplifying the V-genes from the IgM mRNA of B cells of...

Ngày tải lên: 13/10/2015, 16:41

... thoracotomy by using a hyaluronate-based absorbable membran in rats [6] Also, Getman et al achieved the same effect by using haemostatic membrane [7] The present study investigates the efficacy of ... Use of Laboratory Animals Statistical analysis The results were recorded by the principal investigator and analyzed statistically upon completion of the study The statistical analy...

Ngày tải lên: 25/10/2012, 11:00

... distribution of the sensing films composed of (a) P-25 commercial particles, (b) TiO2 nanotubes obtained by hydrothermal treatments for 24 h at 230oC, (c) TiO2 nanotubes ball milled for h, and (d) TiO2 nanotubes ... test gas, respectively Results and Discussion 3.1 Characterization of nanotubular TiO2 films Figure shows SEM images of the surface of TiO2 thick films compos...

Ngày tải lên: 19/03/2014, 16:47

... mimics of the fusion proteins of other retroviruses, and of orthomyxoviruses, paramyxoviruses, filoviruses, coronaviruses, and herpesviruses have also been identified and shown to inhibit viral ... Figure combination Inhibitory effect of peptides WN53 and DN59 alone and in Inhibitory effect of peptides WN53 and DN59 alone and in combination WN53 and DN59 peptides wer...

Ngày tải lên: 19/06/2014, 08:20

... 0–7 .3 0–6.7 17/7748 31 /10 132 33 /10728 47/14900 46/9 536 52/15496 2.2 3. 1 3. 1 3. 2 4.8 3. 4 3. 3 ± 0.8 4.1 3. 5 6.1 3. 6 6.8 6.5 5.1 ± 1.5 5/17005 16/24165 9/ 232 70 16/2 237 5 25/20585 8/16110 29/ 233 35 32 /30 515 ... ratio in domain III of viral isolates 3H was caused by the value of of dS at the denominator The positive selection on the domain III is not su...

Ngày tải lên: 19/06/2014, 08:20

... among various regions of full- length sequences of different genotypes of DENV-3 With the lack of full- length sequences of viruses belonging to old American genotype IV, only four DENV-3 genotypes, ... http://www.virologyj.com/content/5/1/63 Table 4: Comparison of sequence diversity (p-distance, %) of full- length genomic sequences among different genotyp...

Ngày tải lên: 20/06/2014, 01:20

... Ecuador00b I I I I I I I I I I I I I I I I I I I I I I (V)b I (V)b I (V)b II II II II II II II II II II II II II II II III III III III III III III III III III III III III III III III III III III III 1998 ... Asia/S.Pacific (I) India (III) India (III) India (III) India (III) India (III) India (III) India (III) India (III) India (III) India (III) In...

Ngày tải lên: 20/06/2014, 01:20

... outbreak in northern India in 2003 and its continued dominance again in 2004 indicates the resurgence of dengue- 3 in a dominant form The emergence of a newer dengue serotype after an interval ... III) The reemergence of highly fatal subtype III of DEN-3 in a dominant form, replacing the earlier circulating subtype IV of DEN-2 in India is a matter of great concern...

Ngày tải lên: 20/06/2014, 01:20

... mimics of the fusion proteins of other retroviruses, and of orthomyxoviruses, paramyxoviruses, filoviruses, coronaviruses, and herpesviruses have also been identified and shown to inhibit viral ... Figure combination Inhibitory effect of peptides WN53 and DN59 alone and in Inhibitory effect of peptides WN53 and DN59 alone and in combination WN53 and DN59 peptides wer...

Ngày tải lên: 20/06/2014, 04:20

... 0–7 .3 0–6.7 17/7748 31 /10 132 33 /10728 47/14900 46/9 536 52/15496 2.2 3. 1 3. 1 3. 2 4.8 3. 4 3. 3 ± 0.8 4.1 3. 5 6.1 3. 6 6.8 6.5 5.1 ± 1.5 5/17005 16/24165 9/ 232 70 16/2 237 5 25/20585 8/16110 29/ 233 35 32 /30 515 ... ratio in domain III of viral isolates 3H was caused by the value of of dS at the denominator The positive selection on the domain III is not su...

Ngày tải lên: 20/06/2014, 04:20

... Rapid detection of sacbrood virus (SBV) by one-step reverse transcription loop-mediated isothermal amplification assay ArticleCategory : Short Report ... simple detection of SBV by RT-LAMP with high sensitivity and analytic specificity Keywords Sacbrood virus, Loop-mediated isothermal amplification, SYBR Green, Honeybee Sacbrood virus (SBV) prim...

Ngày tải lên: 21/06/2014, 19:20