Genomic analysis of chemo resistance to HDAC inhibitor in gastric cancer cells

... of gastric cancer cells to HDAC inhibitors……………… ……113 6.2 The heterogeneous response of gastric cancer cell lines to HDAC inhibitors……………………………………………………………………………………… …………114 6.3 HDAC inhibitors ... treatment of cancer, HDAC inhibitors will be applied into more and more clinical trial of different type of cancers Thus it is necessary to understand the resis...

Ngày tải lên: 10/09/2015, 09:06

... 3.4.2 Recurrent CD44- SLC1A2 fusion in gastric tumor samples 113 3.4.3 Confirmation of CD44/ SLC1A2 genomic inversions in fusion 116 positive primary gastric tumors 3.4.4 Tumors expressing high SLC1A2 ... of chromosomal inversion model of CD4 4SLC1A2 gene fusion in SNU16 89 Figure 3.6 Protein expression of CD44- SLC1A2 92 Figure 3.7 CD44- SLC1A2 si...

Ngày tải lên: 09/09/2015, 18:49

... initiated to examine the potential of these three bacteriophages for lysogeny, to ensure they did not harbor virulence or toxin genes and to better understand the genetic basis of their host specificity ... Carrias et al.: Comparative genomic analysis of bacteriophages specific to the channel catfish pathogen Edwardsiella ictaluri Virology Journal 2011...

Ngày tải lên: 11/08/2014, 21:21

... of PrPC-induced cell drug resistance in gastric cancer cells PI3K/Akt is involved in the activation of P-gp by PrPC in gastric cancer To further investigate the underlying mechanism of PI3K/Akt- mediated ... significantly increased The results indicate that inhibition of the PI3K/Akt signaling pathway may lead to inhibition of the MDR indu...

Ngày tải lên: 07/03/2014, 03:20

... antigenic determinants consisted predominantly of proinflammatory cytokines, IFNγ and TNFα Furthermore, higher levels of proinflammatory cytokine secretion correlated with reduced severity of arthritis ... immune cells to undergo a Th1 to T-helper type shift and increase the secretion of anti-inflammatory cytokines IL-10 and IL-4, while decreasing the secretion of proinflamm...

Ngày tải lên: 09/08/2014, 14:22

... measurements Table Primers for Q RT-PCR Primer Alias Sequence 1082 ACT1F GCCTTCTACGTTTCCATCCA 1083 ACT1R GGCCAAATCGATTCTCAAAA 1367 PAC2F AATAACGAATTGAGCTATGACACCAA 1368 PAC2R AGCTTACTCATATCGATTTCATACGACTT ... of BNA2, intracellular NAD+ levels may be maintained by the NAD+ salvage pathway Further experiments are required to determine the mechanism by which BNA2 affects telome...

Ngày tải lên: 14/08/2014, 21:20

... VE-465 alone or in combination with 15 ng/mL paclitaxel (Fig 4E) VE-465 Synergizes with paclitaxel to induce apoptosis at low doses specific to Aurora- A We observed increased apoptosis at low doses ... phosphorylation of a known mitotic marker in ovarian cancer cells VE-465 Induces Apoptosis in Ovarian Cells We hypothesized that treatment with VE-465 would...

Ngày tải lên: 18/06/2014, 15:20

... http://www.wjso.com/content/8/1/71 Figure The feeding tube in the wrong location into the fistula duct absolute restriction of oral route and the administration of antibiotics From the point of view of the nutritional assistance ... towards the use of enteral nutrition in these cases is not because enteral nutrition per se, but basically because of the...

Ngày tải lên: 09/08/2014, 03:22

... staining of STC-1 in tumor tissues of nude mice STC-1 was detected on the membrane of tumor cells (D) Immunohistochemical staining of PCNA in tumor tissues of nude mice PCNA was detected in the ... Signaling Technology, USA) at 1: 1000, and the anti-btubulin rat monoclonal antibody (Beyotime, China) at 1:1000 VEGF Assay VEGF content in tumor culture supernatants...

Ngày tải lên: 10/08/2014, 05:21

... patients in total that had died COX-2, VEGF-C and D2-40 expression in gastric carcinoma Positive expression of COX-2 protein and VEGF-C showed as a yellow or brownish yellow stain in the cytoplasm of ... immunoreactivity for COX-2 and VEGF-C Immunoreactivity of D2-40 proteins was found in the cytoplasm and cellular membrane of lymphatic Figure Immunohistoc...

Ngày tải lên: 10/08/2014, 10:21

... objectives of the study are to: Validate breast cancer cells as a model to study the dual inhibition of mTOR and telomerase Investigate rapamycin s inhibition of the mTOR pathway and telomerase in breast ... test the efficacy of mTOR kinase domain inhibitors in preclinical and clinical studies (Menon and Manning 2008) These will be discussed in det...

Ngày tải lên: 05/10/2015, 13:53

... Interferon-Regulatory Factor-1 Suppressor of Cytokine Signaling-3 Suppressor of Cytokine Signaling-1 Signal Transducer Activator of Transcription Interferon Gamma Receptor- Membrane Cytoplasmic/Nuclear Cytoplasmic ... survival of fibroblasts by sup- Page of 13 (page number not for citation purposes) Respiratory Research 2007, 8:34 http://respiratory-research.com/content/8/1/34 T...

Ngày tải lên: 12/08/2014, 15:20

... M.-H Pinard-van der Laan et al INTRODUCTION For the analysis of genetic control of health traits in domestic animals, there is a growing interest for selection experiments as a powerful tool to ... the genetic variability of these traits and to create extreme phenotypes allowing the analysis of underlying mechanisms and the search for new genetic markers o...

Ngày tải lên: 14/08/2014, 13:22

... format and some types of business letter - Finding out some common mistakes in writing an English business letter - Analyzing and suggesting some techniques in order to have good will in writing English ... decided to choose “ An analysis on some techniques to improve writing English business letter” as the topic for my research with the hope tha...

Ngày tải lên: 11/12/2013, 23:57

... Thesis Chapter ENGLISH AND VIETNAME se IDIOMS REFERRING TO BODY PARTS 2.1 English and Vietnamese idioms referring to body parts 2.1.1 The elements of body parts in English idioms Up to now, there ... some types of exercises to improve the ability of using idioms referring to body parts of the learners Objects of the study a Idioms...

Ngày tải lên: 12/12/2013, 00:03