Development of compliant mechanisms for real time machine tool accuracy enhancement using dual servo principle

... its performance characteristics Followed by, the real- time compensation of the following error using the dual servo concept is verified (machines’ servo and secondary flexure mechanisms servo) ... capabilities of using the DTM are manyfolds, still its cost is sky-high To improve the surface integrity of machined components in DTM and to reduce the initial cost of mach...

Ngày tải lên: 10/09/2015, 09:04

... template DNA preparation GPV CHV strain, a high-virulence strain of GPV, was obtained from Key Laboratory of Animal Diseases and Human Health of Sichuan Province Aleutian disease virus (ADV), canine ... size (bp) GPV-F GPV-R GPV-FP GTGCCGATGGAGTGGGTAAT ACTGTGTTTCCCATCCATTGG 6FAM-FTCGCAATGCCA ATTTCCCGAGGP TAMRA AAGCTTTGAAATGGCAGAGGGAGGA GGATCCCGCCAGGAAGTGCTTTATTTGA 3084-3103 3122-3143...

Ngày tải lên: 12/08/2014, 04:20

... demonstrated that the established FQ -PCR assay is of highly specific The intra -assay and inter -assay CV of this established FQPCR was in the range of 1–3% for most of the dynamic range (from 1.0 × 109 ... TaqMan real-time PCR method Results Development and optimization of FQ -PCR and conventional PCR Following the optimization of FQ -PCR, final concent...

Ngày tải lên: 12/08/2014, 04:21

... demonstrated that the established FQ -PCR assay is of highly specific The intra -assay and inter -assay CV of this established FQPCR was in the range of 1–3% for most of the dynamic range (from 1.0 × 109 ... TaqMan real-time PCR method Results Development and optimization of FQ -PCR and conventional PCR Following the optimization of FQ -PCR, final concent...

Ngày tải lên: 12/08/2014, 04:21

... Ashton AR, Tanner GJ, Robinson SP: Proanthocyanidin synthesis and expression of genes encoding leucoanthocyanidin reductase and anthocyanidin reductase in developing grape berries and grapevine ... developmental and cellular processes Realtime RT-PCR is currently one of the more powerful and sensitive techniques for analyzing gene expression It provides outstanding accur...

Ngày tải lên: 12/08/2014, 05:20

... number of sensors We propose a TDMA scheduling algorithm that complies to the characteristics of both, that is, it is flexible, but also makes use of a rigid framework By means of Egyptian Fractions ... 19800 Number of bytes scheduled id is determined by the number of slots within a frame, while the size of the frame information is determined by the precision of...

Ngày tải lên: 21/06/2014, 02:20

... evolution of public sentiment toward the contenders Conclusion We presented a system for real-time Twitter sentiment analysis of the ongoing 2012 U.S presidential election We use the Twitter “firehose” ... aggregate sentiment and tweet volume within each time period for each candidate For volume, the system outputs the number of tweets every minute for each c...

Ngày tải lên: 16/03/2014, 20:20

... technologies for the real-time label-free detection and characterization of protein interactions that may provide higher resolution functional data Common methods for studying protein interactions Current ... protein interactions with nonprotein biomolecules will depend on the development of labelfree methods for measuring the interactions Coupling functiona...

Ngày tải lên: 23/03/2014, 15:21

... proposed a rules-based framework for reconfiguring distributed classifiers for a delay-sensitive stream mining application with dynamic stream characteristics By gathering information locally at each ... binary classifier partitions input data objects into two classes, a “yes” class H and a “no” class H A binary classifier chain is a special case of a binary classi...

Ngày tải lên: 21/06/2014, 19:20

... loosing real-time capability The formulation allows for the combination of an arbitrary number of histograms with different dimensions and sizes, as well as individual distance functions for each ... mechanism for online adaptation of the feature weights Alternatively, instead of the linear combination D∗ (x) of the distances Dh (q(h) (x(0)), q(h) (x(t))), a linear com...

Ngày tải lên: 22/06/2014, 00:20

... compares the performance of a number of transform-based features (including novel features extracted using the discrete curvelet transform) as well as feature set selection methods for visual speech ... “Detection and tracking of humans and faces,” by S Karlsson et al., a framework for multi-object detection and tracking is proposed, and its performance is demonstrated on videos of...

Ngày tải lên: 22/06/2014, 00:20

... able to further reduce the ZQDCT coefficients for intratransform and quantization and thus has better real-time performance for video encoding Although the video quality degradation is slightly worse ... characteristics of the proposed method and the reference codec [14] for (a) Foreman, (b) Glasgow, (c) Akiyo, and (d) Miss America Additional operations are performed for the cal...

Ngày tải lên: 22/06/2014, 00:20

... CONCLUSION In this paper, an embedded system for real-time digital processing of US signals has been presented The system is capable of transmitting arbitrary waveforms, simultaneously demodulating ... perform all needed processing in real time In this paper, an embedded system for multichannel multigate (MCMG) US echography is described The system was conceived an...

Ngày tải lên: 22/06/2014, 01:20

... NEAR- INFRARED CONFOCAL RAMAN SPECTROSCOPY FOR REAL- TIME DIAGNOSIS OF CERVICAL PRECANCER SHIYAMALA DURAIPANDIAN 2014 NEAR- INFRARED CONFOCAL RAMAN SPECTROSCOPY FOR REAL- TIME DIAGNOSIS OF CERVICAL ... adjunct to colposcopy for realizing real- time in vivo diagnosis of cervical precancer IX List of Figures Figure 1.1 Anatomy of cervix...

Ngày tải lên: 10/09/2015, 09:24

... develop a controller for temperature control inside a room within a desired band of temperatures for comfort The details of the geometry of the room and the HVAC system based on displacement ventilation ... disadvantages of the DMC controller First, the DMC controller is a local controller which can only guarantee the stability of the...

Ngày tải lên: 05/09/2013, 16:11