Studies on nanostructured anti reflective coatings
... characterization 117 Conclusion 121 Conclusion and Future Work 7.1 Conclusion 122 VI 7.2 Key research contributions 123 7.3 Future work 124 Bibliography 127 Appendix A: Supporting information for fabrication ... additional power consumption Planar glass used in architectural or decorative applications, also confront aesthetic limitations due to reflection Moreover, Chapter reflection of light...
Ngày tải lên: 09/09/2015, 11:29
... results in the formation of a non-uniform, lithium alkyl carbonate passivation film on the anode surface, which is a lithium- ion conductor but an electronic insulator Although Liions can pass through ... electronic conductivity (
Ngày tải lên: 10/09/2015, 09:27
... Abbreviations xv List of Publications xix CHAPTER INTRODUCTION 1. 1 Parthenolide 1. 1 .1 Introduction: feverfew and Parthenolide 1. 1.2 Chemical structure, metabolism and bioactivities of parthenolide 1. 1.2 .1 ... balance 1. 2 .1 Reactive Oxygen Species 17 1. 2 .1. 1 Definition 17 1. 2 .1. 2 Sources of ROS 18 1. 2.2 Biothiols 19 1. 2.2 .1 Definition 19 1. 2.2.2...
Ngày tải lên: 16/09/2015, 17:14
Studies on the anti cancer potential of sesquiterpene lactone parthenolide
... focused on the anti- inflammatory activity of parthenolide On the other hand, the anti- cancer potential of parthenolide has rarely been studied Thus, the main objective of this study is to further ... investigate the anti- cancer potential of parthenolide by studying its sensitization effects on cancer cells in response to death receptor ligands To...
Ngày tải lên: 16/09/2015, 17:14
Báo cáo hóa học: " Studies on Preparation of Photosensitizer Loaded Magnetic Silica Nanoparticles and Their Anti-Tumor Effects for Targeting Photodynamic Therap" ppt
... effector of PDT Therefore, photosensitizer loaded silica nanoparticles are different from conventional delivery systems which need releasing of the loaded drug [9] Previous investigations of fluorescent -magnetic ... fluorescent -magnetic nanoparticles mainly focused on the MRI imaging and fluorescence imaging for diagnosis; however, there are few studies on the mul...
Ngày tải lên: 22/06/2014, 01:20
Some studies on a probabilistic framework for finding object-oriented information in unstructured data
... framework for finding object-oriented information in unstructured data Two above solutions can be plausible for solving object search problem Yet, the Information Extraction based solution has ... they also have some shortcomings Information Extraction based solution has low scalability and low adaptability while Text Information Retrieval based solution has high sca...
Ngày tải lên: 23/11/2012, 15:04
Tài liệu Báo cáo khoa học: Studies on structural and functional divergence among seven WhiB proteins of Mycobacterium tuberculosis H37Rv pdf
... properties of WhiB2 , WhiB5 , WhiB6 and WhiB7 of M tuberculosis and also compare the properties of all seven WhiB proteins We show that, similar to WhiB3 and WhiB4 , other freshly purified WhiB proteins ... preparations) A + – + – + + + + – + + + + + + + + + 10X 10X 10X 10X 10X 0.1X WhiB IscS 35S-Cys Samples Atoms of iron per monomer WhiB1 WhiB1 WhiB1 WhiB...
Ngày tải lên: 18/02/2014, 12:20
Tài liệu Báo cáo khoa học: Structural and functional studies on a mesophilic stationary phase survival protein (Sur E) from Salmonella typhimurium ppt
... template using Deep Vent DNA polymerase (New England Biolabs, Ipswich, MA, USA), a sense primer (CATATGGCTAGC ATGCGCATATTGCTGAGTAAC) containing an NheI site and an antisense primer (TTAGGATCCTTACCATTGCG ... Salmonella typhimurium SurE A Pappachan et al phase and under conditions of high temperature and high salt compared with parent strains that had the intact surE gene [1] Th...
Ngày tải lên: 18/02/2014, 14:20
Tài liệu Báo cáo khoa học: Structure determination and biochemical studies on Bacillus stearothermophilus E53Q serine hydroxymethyltransferase and its complexes provide insights on function and enzyme memory doc
... Crystal structure of E53QbsSHMT and its complexes Table Data collection statistics of E53QbsSHMT and its complexes Values in parantheses correspond to highest resolution bin Ligand(s) used None Gly ... belonged to the P21212 space group and contained one monomer in the asymmetric unit Cell dimensions and details of data collection are shown in Table Expression and purificat...
Ngày tải lên: 18/02/2014, 16:20
Tài liệu Báo cáo khoa học: Comparative studies on the functional roles of N- and C-terminal regions of molluskan and vertebrate troponin-I pdf
... 6A,B) In the present study, we compared the functional roles of the N- and C-terminal regions of 4482 H Tanaka et al molluskan and vertebrate TnI and revealed for the first time that (a) the alternative ... of the troponin complex In molluskan muscles, the C-terminal region does not function and troponin regulates contraction only through the act...
Ngày tải lên: 20/02/2014, 01:20
Tài liệu Báo cáo Y học: Studies on the nonmevalonate pathway of terpene biosynthesis The role of 2C-methyl-D -erythritol 2,4-cyclodiphosphate in plants docx
... group of Glu207 into phytoene (the main labeled component of the lipidsoluble fraction) is systematically diminished by the addition of increasing amounts of [1-3H ]2C-methyl-D -erythritol 4-phosphate ... Formation of 4-(cytidine 50 -diphospho)-2-C-methyl-D -erythritol from 2-C-methyl-D -erythritol 4-phosphate by 2-C-methyl-D -erythritol 4-phosphate cytidyltran...
Ngày tải lên: 22/02/2014, 07:20
Case Studies on the Effectiveness of State Financial Incentives for Renewable Energy pdf
... regions of the state On the other hand, only a small fraction of those claiming the tax credit take advantage of the low-interest loan Furthermore, the property-tax exemption complements the ... National Laboratory, Matthew Brown of the National Conference of State Legislatures, Jane Weissman of the Interstate Renewable Energy Council, Frederick Beck of...
Ngày tải lên: 06/03/2014, 19:20
Báo cáo khoa học: Studies on the role of the receptor protein motifs possibly involved in electrostatic interactions on the dopamine D1 and D2 receptor oligomerization pdf
... co-expressing dopamine D1 and D2 fusion proteins (D1 CFP and D2R1–YFP – genetic variant of dopamine D2 receptor) d Measured in cell co-expressing dopamine D1 and D2 fusion protein (D1 CFP and D2R2–YFP ... two dopamine D2 receptor fusion proteins (D2 CFP and D2 YFP) f Measured in cell co-expressing two dopamine D2 receptor fusion proteins (D2 CFP...
Ngày tải lên: 07/03/2014, 03:20
Báo cáo khoa học: Studies on structure–function relationships of indolepyruvate decarboxylase from Enterobacter cloacae, a key enzyme of the indole acetic acid pathway ppt
... ensure the generation of the ketone The ability of ScPDC and ZmPDC to decarboxylate indolepyruvate was examined under the same conditions In the case of ZmPDC maximum enzyme concentration was 2.3 ... independent of the concentration of the auxiliary enzyme, confirming that the coupled assay monitors the true rate of EcIPDC catalysis Figs and and Table illustr...
Ngày tải lên: 08/03/2014, 02:20
STUDIES ON CATTLE MILK AND MEAT PRODUCTION IN FOGERA WOREDA: PRODUCTION SYSTEMS, CONSTRAINTS AND OPPORTUNITIES FOR DEVELOPMENT doc
... declined due to production constraints such as lack of production inputs and lack of information on dairy and beef production and marketing and also the dairy and beef market are localized Therefore, ... the production constraints of milk and meat of the woreda and to indicate the interventions for the indicated production constraints LITERATURE REVIEW 2....
Ngày tải lên: 08/03/2014, 23:20