Device independent playground investigating and opening up a quantum black box

... mean values and covariance matrix, Γ given by Γ= = where a = a p (a) ∗ a, fa=1 fa=1 fb=1 fa=1 fb=1 fb=1 1− a ab − a b ab = , ab − a b 1− b a, b p (a, b) ∗ a ∗ b (4.14) , (4.15) are the average values ... Wang Yimin, Wu Xingyao, Lana Sheridan, Haw Jing Yan, Jiri Minar, Rafael Rabelo, Daniel Cavalcanti and Alexandre Roulet Not forgetting also many of my overseas collaborators...

Ngày tải lên: 09/09/2015, 11:23

... shape and alignment and declined the periodontal surgery It was explained that her central incisors would have a squared shape and would appear shorter and wider In her case, a diagnostic mock-up ... patient communication _ diagnostic mock-up I Fig 6 _Diagnostic mock-up (Case I) Fig 7_Intra-oral view of diagnostic mock-up (Case I) Fig help patients understand a...

Ngày tải lên: 19/02/2014, 17:20

... Substitution as avoidance: The issue of paper vs plastic” Paper bag vs plastic bag at grocery store Paper cup vs polystyrene cup In each case, the life-cycle analysis shows that the non -paper choice ... on account of paper that cannot be recycled, such as archives and libraries, and papers used in construction materials (eubusiness.com) Same data displayed graphically 20 Corr...

Ngày tải lên: 09/03/2014, 00:20

... CAGGTTAAA TATTAGGAGGCTGTAGGCA 6541m_27-0 CAGGTtAAA TATTAGGAGGCTGTAGGCA 6290m_1232 CAGGTTAAA TATTAGGAGGCTGTAGGCA 467h_969-0 CAGGttAAA TATTAGGAGGCTGTAGGCA Consensus CAGGTTAAATATTAGGAGGCTGTAGGCA ... The hepatitis B virus (HBV) is a small double stranded DNA virus that produces a chronic infection in 2–10% of adults and in approximately 90% of infected infants Approximately 10% of the...

Ngày tải lên: 19/06/2014, 08:20

... CAGGTTAAA TATTAGGAGGCTGTAGGCA 6541m_27-0 CAGGTtAAA TATTAGGAGGCTGTAGGCA 6290m_1232 CAGGTTAAA TATTAGGAGGCTGTAGGCA 467h_969-0 CAGGttAAA TATTAGGAGGCTGTAGGCA Consensus CAGGTTAAATATTAGGAGGCTGTAGGCA ... The hepatitis B virus (HBV) is a small double stranded DNA virus that produces a chronic infection in 2–10% of adults and in approximately 90% of infected infants Approximately 10% of the...

Ngày tải lên: 20/06/2014, 04:20

... this article as: Bilotta et al.: Older People’s Quality of Life (OPQOL) scores and adverse health outcomes at a one-year follow-up A prospective cohort study on older outpatients living in the community ... outpatients in Italy A one-year prospective cohort study Arch Gerontol Geriatr 2011 Bilotta C, Bowling A, Nicolini P, Cas...

Ngày tải lên: 20/06/2014, 15:20

... Messaoudi, SA, Tatar, N-E: Exponential and polynomial decay for a quasilinear viscoelastic problem Nonlinear Anal 68, 785–793 (2007) Messaoudi, SA: General decay of solutions of a viscoelastic ... for b = and b = and for a wider class of relaxation functions He established a more general decay result, for which the usual exponential and polynomi...

Ngày tải lên: 21/06/2014, 00:20

... describes a research whose goal is to “understand and encapsulate gestural interaction in such a way that gesticulation can be treated as a datatype—like graphics and speech and incorporated into any ... speech audio, time-tagged speech transcription, and derived signal data [106, 107, 108] To demonstrate the efficacy of the catchment feature concept, both as a device fo...

Ngày tải lên: 23/06/2014, 01:20

... article as: Richter et al.: Long-term follow-up after en bloc resection and reconstruction of a solitary paraganglioma metastasis in the first lumbar vertebral body: a case report Journal of Medical ... supervised the writing of the manuscript URL and HFH performed the operation HFH, URL and TL supervised the general management and fo...

Ngày tải lên: 11/08/2014, 00:22

... compare annual prevalence rates for suicidal ideation and suicide attempts at baseline and four years later; and, to compare new cases of and remission from serious suicidality (i.e., suicidal ... this article as: Fairweather-Schmidt et al., Baseline factors predictive of serious suicidality at follow-up: findings focussing on age and gender fro...

Ngày tải lên: 11/08/2014, 16:22

... anterior abdominal wall in the right iliac fossa (RIF) with foreign body granuloma formation, mimicking an acute appendicular lump Case presentation A 25-year-old woman was referred to us with a day ... Mittal S, Gupta I, Lata P, Mahajan U, Gupta AN: Management of translocated and incarcerated intrauterine contraceptive devices Aust NZ J Obstet Gynaeco...

Ngày tải lên: 11/08/2014, 17:21

... Journal of Cancer 2005, 41:1679-1709 doi:10.1186/1477-7525-8-69 Cite this article as: Taminiau-Bloem et al.: A ‘short walk’ is longer before radiotherapy than afterwards: a qualitative study questioning ... General Practice, Academic Medical Center, University of Amsterdam, Amsterdam, The Netherlands Department of Radiotherapy, Academic Medical Center, Universit...

Ngày tải lên: 12/08/2014, 01:21

... experiments and data acquisition MV conducted experiments, interpretation of data, and manuscript drafting GB performed study conception and design, statistical analysis and interpretation of data, and ... none of them demonstrated a clear superiority and became the standard Pharmacologic approaches included nitric oxide inhalation, surfactant replacement therapy, antiox...

Ngày tải lên: 13/08/2014, 03:20

... Ann Meeting American Dairy Science Assoc Columbia Van Vleck L.D (1977) Theoretical and actual genetic progress in dairy cattle In: Proc Int Conf Quantitative Genetics (E Pollak, O Kempthome and ... change in dairy cattle by embryo transfer and splitting Anim Prod 36, 341-353 Rendel J.M & Robertson A (1950) Estimation of genetic gain in milk yield by select...

Ngày tải lên: 14/08/2014, 19:23