Use of formic acid formates as hydrogen source for reactions

... production of -valerolactone, a sustainable liquid for carbon-based chemicals for energy, from biomass-derived levulinic acid and formic acid was reported The use of formic acid as the hydrogen ... Great efforts have been made to study and improve the hydrogen production from formic acid/ formates decomposition Focus has been more on formic acid than format...

Ngày tải lên: 09/09/2015, 10:15

... studies the use of the Internet tool as an assistance for first-year non-major students at Namdinh University of Technology Education (NUTE) in basic English self-study That is the students use of ... developing as well The next is the intergrating technology especially the Internet with web-based activities into the syllabus u...

Ngày tải lên: 04/08/2015, 09:41

... data and writing the manuscript MU was involved in the overall supervision, preparation of the questionnaire and collection and analysis of data TA was involved in the study design, analysis and ... important factors that Table Different methods of blood conservation and their complications Alternatives used to avoid allogenic blood transfusions and their disadvantag...

Ngày tải lên: 20/06/2014, 04:20

... data and writing the manuscript MU was involved in the overall supervision, preparation of the questionnaire and collection and analysis of data TA was involved in the study design, analysis and ... important factors that Table Different methods of blood conservation and their complications Alternatives used to avoid allogenic blood transfusions and their disadvantag...

Ngày tải lên: 20/06/2014, 07:20

... article as: Zhou et al.: Facile template-free synthesis of pine needle-like Pd micro/nano-leaves and their associated electro-catalytic activities toward oxidation of formic acid Nanoscale Research ... performance of as-prepared catalysts for the formic acid electro -oxidation The inset of Figure shows the CV of formic acid oxidation on the Pd...

Ngày tải lên: 21/06/2014, 03:20

... doi:10.1186/1743-422X-8-18 Cite this article as: Lee et al.: Characterization of thiobarbituric acid derivatives as inhibitors of hepatitis C virus NS5B polymerase Virology Journal 2011 8:18 Submit your next manuscript ... when screening a chemical library against HCV NS5B, we found a series of thiobarbituric acid compounds to be potent inhibitors of HCV N...

Ngày tải lên: 11/08/2014, 21:21

... improvement in the t of the environmental covariance was obtained when relaxing the assumption of constant residual variance, and was clearly shown in the score statistic values A much simpler model was ... parameters on the sub-diagonals and D is a diagonal matrix of the inverse of innovation variances Score and information matrices for D and L parameters ca...

Ngày tải lên: 14/08/2014, 13:22

... UUAGGACAUAUAGUUAGCCCUAGG unknown UGGGU CUAGACUAGA CCAGUAGAUCCUAGACUAGA GAAGAAGCGGAGACAGCGACGAAGA AGAUCCAUUCGAUUAG unknown UAGUGAAUAGAGUUAGGCAGGGA GAAGAAGAA UAGAAGAAGAA 4995–5017 [5, 12, 38, 40] 5362–5366 ... coactivators J Virol 76, 9724–9734 HIV-1 alternative splicing regulation 34 Kuramitsu M, Hashizume C, Yamamoto N, Azuma A, Kamata M, Yamamoto N, Tanaka Y & Aida Y (2005) A novel...

Ngày tải lên: 06/03/2014, 09:22

... Y. C & Yin, T.G (1992) Interleukin-11 and its receptor Biofactors 4, 15±21 Yin, T.G., Miyazawa, K & Yang, Y. C (1992) Characterization of interleukin-11 receptor and protein tyrosine phosphorylation ... regulation of production of pro-in¯ammatory cytokines such as TNF-a, IL-1b, IFN-c and IL-12 by monocytes [55,56], and that the IL-11 receptor analysis on human cell...

Ngày tải lên: 24/03/2014, 00:21

... 5¢-CATCTTGAAAGTCGGTGCGGGAGAAGCAA CACAATGC-3¢ (the reverse primer was the complementary sequence); pCA(E45 7A) forward primer, 5¢-CATCTTGA AAGTCGGTAAGGGAGCAGCAACACAATGC-3¢ (the reverse primer was the ... Simoes et al ˜ Cardosin A associates with phospholipase Da A Fig Cardosin A interacts with the C2 domain of PLDa Pull-down assays for cardosins A and B were per...

Ngày tải lên: 30/03/2014, 11:20

... relationship to information A THOUGHT EXPERIMENT THE DIAMOND AGE The Universal Copymachine Physics + Culture at the heart of the problem THE BUFFALO CULTURE Doing More in the Land of Less USING THE WHOLE ... 1254-1325 “BEATUS” MAP CATALAN ATLAS 1375 PTOLEMY 90-168 RISE OF THE MERCHANT CLASS THE AGE OF EXPLORATION THE RISE OF DEMOCRACY MANIFEST DESTINY ASPIRATIONA...

Ngày tải lên: 03/06/2014, 18:27

... study was limited in its scope, the results indicate that WNV strain IS-98-ST1 is suitable as viral model for West Nile encephalitis in the Old World The Israeli strain IS-98-ST1 that caused the ... the fact that an Israeli WNV strain was introduced in New York City in 1999 [4] The murine model of WNV-associated encephalitis has been wid...

Ngày tải lên: 18/06/2014, 22:20

... design of mode identification strategies for reconfigurable software-defined radio- based terminal His research interests are in mode identification algorithms for software-defined radio platform in a single ... Van Dyck, and A Soltanian, “Interference of bluetooth and IEEE 802.11: simulation modeling and performance evaluation,” in Proc 4th International ACM...

Ngày tải lên: 23/06/2014, 01:20

... nucleofected samples The majority of the samples we analyzed were bone marrow aspirates In patients with advanced disease, autologous bone marrow may prove to be both an accessible and abundant source ... marrow involvement For example, the large amount of tumor material typically available from leukemia patients makes these cells accessible for autologous patient-derived vaccine...

Ngày tải lên: 14/08/2014, 19:22