Development of smoothed methods for fluid structure interactions
... DEVELOPMENT OF SMOOTHED METHODS FOR FLUID STRUCTURE INTERACTIONS WANG SHENG (B.Eng., University of Science and Technology Beijing M.Eng., University of Science and Technology ... explorations of the performances of these smoothed methods on solving the pure solid and fluid flow problems are still needed Furthermore, a coupling of those valid smoothed methods...
Ngày tải lên: 09/09/2015, 10:06
... DEVELOPMENT OF NMR METHODS FOR THE STRUCTURAL ELUCIDATION OF LARGE PROTEINS ZHENG YU (B.Sc., Xiamen University) A THESIS SUBMITTED FOR THE DEGREE OF DOCTOR OF PHILOSOPHY DEPARTMENT OF BIOLOGICAL ... analysis of complex, x Development of NMR methods for the structural elucidation of large proteins Summary crowded and folded high-dime...
Ngày tải lên: 11/09/2015, 09:57
... DEVELOPMENT OF MESHFREE METHODS FOR THREE- DIMENSIONAL AND ADAPTIVE ANALYSES OF SOLID MECHANICS PROBLEMS ZHANG GUIYONG (B.Eng., DUT, CHINA) A THESIS SUBMITTED FOR THE DEGREE OF DOCTOR OF PHILOSOPHY ... (LC-PIM) for both 2D and 3D problems, and to apply it to adaptive analysis The RPIM was originally proposed for 2D problems and applied for dif...
Ngày tải lên: 14/09/2015, 08:39
Part development of novel methods for the synthesis of homoallylic alcohols part II multigrams synthesis of ( ) epibatidine
... 25 25 25 Time (h) 2.0 5.0 6.0 1.5 5.0 2.0 Yield %b (1 03:10 4) (E/Z)c 25 (1 00: 0) (8 0/2 0) 23 (1 00: 0) (8 0/2 0) 25 (7 6:2 4) (8 0/2 0) 45 (1 00: 0) (8 0/2 0) 49 (1 00: 0) (8 0/2 0) 69 (1 00: 0) (8 0/2 0) 105 105a 105b ... Yield 9a (% ) ( : ) (E/Z) 15 (7 5:2 5) (1 00/ 0) 22 (2 3:7 7)...
Ngày tải lên: 16/09/2015, 17:11
Development of computational methods for the rapid determination of NMR resonance assignment of large proteins
... determination is the spectral assignment procedure This involves sequence-specific resonance assignment of NMR signals and the assignment of NOESY spectra Resonance assignment forms the basis for characterizing ... obtain the assignments of the Cα and CO of the same residue Then, the CO frequency is used to obtain assignments for the HN and 15N of...
Ngày tải lên: 04/10/2015, 15:52
Development of smoothed numerical methods for fracture analyses and interfacial toughness characterization in thin film systems
... 1.3 Characterization of interfacial toughness in thin film systems 10 1.3.1 Characterization of interfacial toughness base on normal indentation 11 1.3.2 Characterization of interfacial toughness ... methods for fracture analyses in thin film systems Chapter presents a brief introduction of strain smoothing technique and G space including th...
Ngày tải lên: 10/09/2015, 08:26
Development of DMC controllers for temperature control of a room deploying the displacement ventilation HVAC system
... develop a controller for temperature control inside a room within a desired band of temperatures for comfort The details of the geometry of the room and the HVAC system based on displacement ventilation ... disadvantages of the DMC controller First, the DMC controller is a local controller which can only guarantee the stability of the...
Ngày tải lên: 05/09/2013, 16:11
Báo cáo khoa học: Functional expression of olfactory receptors in yeast and development of a bioassay for odorant screening docx
... used for RT-PCR were: for the I7 OR (5¢-CGTCAAGGAGAAAAAACCCCGGATCT AAAAAATGGAGCGAAGGAACCACAG-3¢) and (5¢-AG CTGCCTGCAGGTCGACTCTAGAGGATCCTAACCAA TTTTGCTGCC-3¢); for OR17-40 (5¢-CGTCAAGGAG AAAAAACCCCGGATCTAAAAAATGGAGCAGAAAC ... recombination introducing the c-myc-OR17-40 coding sequence, using primers (5¢-CGTCAAGGAGAAAAAAC CCCGGATCTAAAAAATGGAGCAGAAACTCATCTC TGAAGAGGATCTG-3¢) and (5¢-G...
Ngày tải lên: 07/03/2014, 16:20
Báo cáo khoa học: " The Development of Lexical Resources for Information Extraction from Text Combining Word Net and Dewey Decimal Classification" potx
... ambiguity in WordNet by combining its information with another source of information: the Dewey Decimal Classification (DDC) (Dewey, 1989) Reducing the lexical ambiguity in W o r d N e t The main ... greatly reduce the ambiguity implied by the use of WordNet by finding the correct set of field labels that cover all the WordNet hierarchy in an uniform way Therefo...
Ngày tải lên: 08/03/2014, 21:20
Interaction Relabelling and Extreme Characters: Methods for Exploring Aesthetic Interactions ppt
... functionality to the actual interaction possibilities Interaction relabelling also helps in exploring roles Different styles of interaction suggest different things about users and how they value the ... Frens designed for three extreme characters: a drugsdealer, the Pope and a polyandrous twenty-year old The characters were not only described in words, but also visualized...
Ngày tải lên: 16/03/2014, 18:20
Báo cáo khoa học: "Theoretical Evaluation of Estimation Methods for Data-Oriented Parsing" pot
... give a more formal treatment of bias and consistency in the context of DOP (7) f P6 i for i = for i = j=1 fj (8) Throughout this paper I take frequencies fi to be relative to the size of the corpus ... again simple combinations of the frequencies f1 f4 Observations of these frequencies therefore not add any extra information, and the problem of finding the weights of the targ...
Ngày tải lên: 17/03/2014, 22:20
DEVELOPMENT OF STUDENTS’ ENGLISH FOR SPECIAL PURPOSES COMPETENCE IN TOURISM STUDIES AT TERTIARY LEVEL potx
... determine students’ ESP Development of students’ English for Special Purposes competence in tourism studies at tertiary level Dr Ineta Luka, School of Business Administration Turiba, Latvia 13 competence ... stage of the research to create the model for the development of students’ ESP competence Development of students’ English for Sp...
Ngày tải lên: 29/03/2014, 23:20