Development of mechanical driven DNA nanomotors

Development of mechanical driven DNA nanomotors

Development of mechanical driven DNA nanomotors

... specificity of base-pairing leads to predictable DNA structure and becomes the basic of the formation of DNA nanomotors and tracks Figure Schematic drawing of a two-nucleotide single-strand DNA The ... light-responsive bipedal DNA nanomotors The engine of the DNA nanomotors is azobenzene-tethered viii hairpins, which absorb light of different colours to achieve a b...

Ngày tải lên: 09/09/2015, 08:18

110 344 0
Development of track walking DNA nanomotors

Development of track walking DNA nanomotors

... activity v List of Publication iii Acknowledgements iv Table of Contents vi Summary ix List of Tables x List of Figures xi Chapter Introduction 1.1 An overview of nanotechnology and role of nanomachines ... ILLUSTRATIONS OF MYOSIN V WALKER 15 FIGURE 2.1 | ILLUSTRATION OF TILE-BASE SELF-ASSEMBLING METHOD 21 FIGURE 2.2 | THE PHOTO-REGULATION OF DNA HYBRIDIZATION OF AZOBENZ...

Ngày tải lên: 30/09/2015, 06:30

134 87 0
Development of gold nanoparticle DNA nanostructure assembly for detection of DNA, RNA and protein biomarkers

Development of gold nanoparticle DNA nanostructure assembly for detection of DNA, RNA and protein biomarkers

... DEVELOPMENT OF GOLD NANOPARTICLE- DNA NANOSTRUCTURE ASSEMBLY FOR DETECTION OF DNA, RNA AND PROTEIN BIOMARKERS SEOW NIANJIA (B.Eng (Hons), National University of Singapore) A THESIS SUBMITTED FOR ... 49 CHAPTER 4: GOLD NANOSTRUCTURES DETECTION OF RNA BIOMARKER - GOLD NANOPARTICLE- DYNAMIC LIGHT SCATTERING TANDEM FOR THE RAPID AND QUANTITATIVE DE...

Ngày tải lên: 09/09/2015, 11:16

142 369 0
Tài liệu Structure Development and Mechanical Performance of Polypropylene docx

Tài liệu Structure Development and Mechanical Performance of Polypropylene docx

... influence of of cooling rate on the structure and resulting mechanical performance is explored for a set of isotactic polypropylenes with varying molecular weight, insertion of co-units and addition of ... kinetics and resulting morphology, the focus of this study is on the quiescent non-isothermal and isobaric crystallization and structure development of isotac...

Ngày tải lên: 22/02/2014, 09:20

156 424 0
Báo cáo y học: " Development of a new ultra sensitive real-time PCR assay (ultra sensitive RTQ-PCR) for the quantification of HBV-DNA" pot

Báo cáo y học: " Development of a new ultra sensitive real-time PCR assay (ultra sensitive RTQ-PCR) for the quantification of HBV-DNA" pot

... 5’-GCCAAAATTCGCAGTCCC-3’, 0.5 μM primer hbv460 (antisense) 5’-GATAGTCCAGAAGAACCAACAAGAAG-3’, 0.4 μM molecular beacon 5’-CG CGCGATGAGGCATAGCAGCAGGATGAAGAACG CGCG-3’ labelled with FAM and Dabcyl at the ... RTQ -PCR assay These findings suggest that the ultra sensitive RTQ -PCR assay is equally reliable as the Figure Comparison of the HBV-DNA values estimated using COBAS TaqM...

Ngày tải lên: 12/08/2014, 04:20

6 537 1
Báo cáo y học: "Changes in the mechanical properties of the respiratory system during the development of interstitial lung edema" ppt

Báo cáo y học: "Changes in the mechanical properties of the respiratory system during the development of interstitial lung edema" ppt

... pulmonary edema[20] Therefore, this study provides the first data concerning modifications in the overall mechanical properties of the respiratory system in vivo during interstitial lung edema ... integration of the flow signal was removed by estimating the linear trend on the integrated signal and removing it from the recording The frequency response of...

Ngày tải lên: 12/08/2014, 15:21

9 387 0
Báo cáo y học: " A validity-driven approach to the understanding of the personal and societal burden of low back pain: development of a conceptual and measurement model" doc

Báo cáo y học: " A validity-driven approach to the understanding of the personal and societal burden of low back pain: development of a conceptual and measurement model" doc

... A validity-driven approach to the understanding of the personal and societal burden of low back pain: development of a conceptual and measurement model Rachelle Buchbinder1,2,*,#, Roy Batterham3,*, ... develop a conceptual and measurement model of the overall burden of low back pain from the individual’s perspective using a...

Ngày tải lên: 12/08/2014, 18:20

39 387 0
Báo cáo sinh học: "Development of avian influenza virus H5 DNA vaccine and MDP-1 gene of Mycobacterium bovis as genetic adjuvant" pptx

Báo cáo sinh học: "Development of avian influenza virus H5 DNA vaccine and MDP-1 gene of Mycobacterium bovis as genetic adjuvant" pptx

... article as: Jalilian et al., Development of avian influenza virus H5 DNA vaccine and MDP-1 gene of Mycobacterium bovis as genetic adjuvant Genetic Vaccines and Therapy 2010, 8:4 ... recombinant vaccines against avian influenza H5N1 virus which are able to induce different levels of protective immunity, such as DNA plasmidbased vaccine, baculovir...

Ngày tải lên: 14/08/2014, 19:22

9 275 0
Development of bismuth based visible light driven photocatalysts for the degradation of organic pollutants

Development of bismuth based visible light driven photocatalysts for the degradation of organic pollutants

... where χ is the electronegativity of the semiconductor which is taken as the geometric mean of the electronegativities of the component elements of the semiconductor, Ee is the energy of the free ... XII Summary Organic pollutants becomes a pervasive threat with the step forward of human beings Photocatalysis is an effective method for the degradation o...

Ngày tải lên: 09/09/2015, 11:16

260 385 0
Investigation of new properties and applications of quadruplex DNA and development of novel oligonucleotide based topoisomerase i inhibitors

Investigation of new properties and applications of quadruplex DNA and development of novel oligonucleotide based topoisomerase i inhibitors

... INVESTIGATION OF NEW PROPERTIES AND APPLICATIONS OF QUADRUPLEX DNA AND DEVELOPMENT OF NOVEL OLIGONUCLEOTIDEBASED TOPOISOMERASE I INHIBITORS WANG YIFAN (B.Sc., Soochow University, China) ... 1.3.1 Discovery of i- Motif Form of DNA 11 1.3.2 Stoichiometries and Topologies of i- Motif DNA 11 ii 1.3.3 Possible Biological Role of i- Motif Structure...

Ngày tải lên: 11/09/2015, 16:04

158 358 0
Development of direct asymmetric aldol reactions mediated by primary amino acid derived organocatalysts  exploring DNA cleaving activities of varacin b and varacin c

Development of direct asymmetric aldol reactions mediated by primary amino acid derived organocatalysts exploring DNA cleaving activities of varacin b and varacin c

... PART Ⅰ: DEVELOPMENT < /b> OF < /b> DIRECT < /b> ASYMMETRIC < /b> ALDOL < /b> REACTIONS < /b> MEDIATED < /b> BY < /b> PRIMARY < /b> AMINO < /b> ACID-< /b> DERIVED < /b> ORGANOCATALYSTS < /b> PART Ⅱ: EXPLORING < /b> DNA-< /b> CLEAVING < /b> ACTIVITIES < /b> OF < /b> VARACIN < /b> B AND VARACIN < /b> C JIANG ZHAOQIN ... 2-hydroxy-γ-butyrolactones 150 Scheme 5-1 Structur...

Ngày tải lên: 14/09/2015, 08:39

282 172 0
Development of DNA vaccines for allergic asthma

Development of DNA vaccines for allergic asthma

... DEVELOPMENT OF DNA VACCINES FOR ALLERGIC ASTHMA TAOQI HUANGFU (MBBS, SHANGHAI SECOND MEDICAL UNIVERISTY, P R CHINA) A THESIS SUBMITTED FOR THE DEGREE OF DOCTOR OF PHILOSOPHY DEPARTMENT OF ... of allergic asthma 26 1.3.1 History of vaccine and DNA vaccine 26 1.3.2 DNA vaccines for allergic asthma and other allergic diseases 30 1.3.3 Current status an...

Ngày tải lên: 15/09/2015, 17:09

386 219 0
Development of a network integrated feature driven engineering environment

Development of a network integrated feature driven engineering environment

... that of a typical application context of a CAD framework Instead of identifying all aspects of the analogy between them, the focus was placed on characterizing the relationship among a group of ... conceptually applicable to the development of an integrated engineering environment for products which have a feature- driven process? • What are the adaptations that...

Ngày tải lên: 15/09/2015, 17:09

230 351 0
Development of indicators on consumer satisfaction and Pilot survey

Development of indicators on consumer satisfaction and Pilot survey

... reputation in the market, overall Development of consumer satisfaction indicators & Pilot survey 39 MARKET AND PERSONAL FACTORS Question MPF1– Evaluation of market conditions and personal factors on ... report and its annexes Development of consumer satisfaction indicators & Pilot survey 15 Consumer Customer expectations Consumer Customer complaints P...

Ngày tải lên: 23/10/2012, 11:54

130 745 0
Báo cáo y học: "A prospective observational study of the relationship of critical illness associated hyperglycaemia in medical ICU patients and subsequent development of type 2 diabetes"

Báo cáo y học: "A prospective observational study of the relationship of critical illness associated hyperglycaemia in medical ICU patients and subsequent development of type 2 diabetes"

... history of diabetes and higher body mass indexes During the five years of follow-up, 1 02 (15 .2% ) patients in the normoglycaemia group and 66 (18.3%) patients in the hyperglycaemia group died There ... inclusion in the study We excluded 21 1 patients who refused to participate in the study, 20 3 patients due to terminal illness, and another 29...

Ngày tải lên: 25/10/2012, 10:02

8 657 1
w