Imaging experience dependent plasticity in the mouse barrel cortex

Imaging experience dependent plasticity in the mouse barrel cortex

Imaging experience dependent plasticity in the mouse barrel cortex

... about inhibitory circuit plasticity in the somatosensory cortex, so the nature of the experiencedependent plasticity that might be occurring in these circuits is unclear In my thesis, I have examined ... of the barrel cortex brings up the question of whether still other circuits are also sensitive to experience Defining which neurons underlie experiencedependent pl...
Báo cáo y học: "Genome-wide expression profiling and bioinformatics analysis of diurnally regulated genes in the mouse prefrontal cortex" pps

Báo cáo y học: "Genome-wide expression profiling and bioinformatics analysis of diurnally regulated genes in the mouse prefrontal cortex" pps

... expression analysis for diurnally regulated genes To gain insights into the tissue specificity of expression levels of diurnally regulated genes, we next examined their expression levels in the ... studies By identifying a large number of diurnally regulated genes in a defined brain region, a clustering analysis resulted in sufficiently large number...
Ngày tải lên : 14/08/2014, 08:20
  • 15
  • 299
  • 0
Báo cáo khoa học: Bioenergetic requirements of a Tat-dependent substrate in the halophilic archaeon Haloarcula hispanica pdf

Báo cáo khoa học: Bioenergetic requirements of a Tat-dependent substrate in the halophilic archaeon Haloarcula hispanica pdf

... Tat-dependent translocation in the haloarchaeon Haloarcula hispanica Using this in vitro assay, as well as in vivo translocation assays, we show that secretion of a Tat-dependent a- amylase does not ... translation (see below), amyH was amplified using chromosomal DNA of H hispanica as template, and primers AmyH-T 7a (atatcatATGAATCGACCCCGAATTACC GGCAG) and AmyH-T7b (...
Ngày tải lên : 23/03/2014, 06:20
  • 9
  • 414
  • 0
Báo cáo sinh học: " Motavizumab, A Neutralizing Anti-Respiratory Syncytial Virus (Rsv) Monoclonal Antibody Significantly Modifies The Local And Systemic Cytokine Responses Induced By Rsv In The Mouse Model" pdf

Báo cáo sinh học: " Motavizumab, A Neutralizing Anti-Respiratory Syncytial Virus (Rsv) Monoclonal Antibody Significantly Modifies The Local And Systemic Cytokine Responses Induced By Rsv In The Mouse Model" pdf

... A. M study design, data analyses, manuscript preparation; SCB data analyses and manuscript review, and MBR performing experiments; JC Luminex data analysis and interpretation PK and HSJ data interpretation; ... control antibody, MEDI-507, at the same time of the administration of the anti -RSV antibody had no effect on the cytokine profile or other clinical and inflam...
Ngày tải lên : 18/06/2014, 18:20
  • 5
  • 357
  • 0
Báo cáo sinh học: " Roles of adjuvant and route of vaccination in antibody response and protection engendered by a synthetic matrix protein 2-based influenza A virus vaccine in the mouse" pdf

Báo cáo sinh học: " Roles of adjuvant and route of vaccination in antibody response and protection engendered by a synthetic matrix protein 2-based influenza A virus vaccine in the mouse" pdf

... 22:477-481 Asanuma H, Aizawa C, Kurata T, Tamura S: IgA antibody- forming cell responses in the nasal-associated lymphoid tissue of mice vaccinated by intranasal, intravenous and/ or subcutaneous administration ... peptide vaccine that contains ectodomains of matrix protein Vaccine 2003, 21:2616-2626 Slepushkin VA, Katz JM, Black RA, Gamble WC, Rota PA, Cox NJ: Protection...
Ngày tải lên : 18/06/2014, 18:20
  • 14
  • 515
  • 0
báo cáo hóa học: " Cyclooxygenase-2 mediates microglial activation and secondary dopaminergic cell death in the mouse MPTP model of Parkinson''''s disease" pptx

báo cáo hóa học: " Cyclooxygenase-2 mediates microglial activation and secondary dopaminergic cell death in the mouse MPTP model of Parkinson''''s disease" pptx

... important role in the secondary activation of microglia, in the progression of the inflammatory response, and in the progressive loss of the dopaminergic neurons in MPTPinduced PD Therefore, COX-2 ... oxidative and inflammatory insults The positive feed back loop may continue until the additional neuronal death (~50% of the remaining of the init...
Ngày tải lên : 19/06/2014, 22:20
  • 16
  • 468
  • 0
báo cáo hóa học: " Activation of retinal microglia rather than microglial cell density correlates with retinal neovascularization in the mouse model of oxygen-induced retinopathy" ppt

báo cáo hóa học: " Activation of retinal microglia rather than microglial cell density correlates with retinal neovascularization in the mouse model of oxygen-induced retinopathy" ppt

... et al.: Activation of retinal microglia rather than microglial cell density correlates with retinal neovascularization in the mouse model of oxygen-induced retinopathy Journal of Neuroinflammation ... deeper microglial cells reside within the outer plexiform layer Of note, in all these layers microglial cells are often found in close associa...
Ngày tải lên : 19/06/2014, 22:20
  • 8
  • 353
  • 0
báo cáo hóa học: " Strain-dependent variation in the early transcriptional response to CNS injury using a cortical explant system" doc

báo cáo hóa học: " Strain-dependent variation in the early transcriptional response to CNS injury using a cortical explant system" doc

... Forward CAGACAACATAAACTGCGCCTT Reverse GATACACCTCTCCACCAATGACC IL- 1a Forward TACTCGTCGGGAGGAGACGACTCT 107 bp NM_010554.4 interleukin alpha Reverse TCCTTCAGCAACACGGGCTGGT IL-1b Forward CCTTCCAGGATGAGGACATGA ... necrosis factor alpha Reverse AAGTGCATCATCGTTGTTCATACA IL-12 P35 Forward GCATGCTGGTGGCCATCGATGA Reverse GCGTGAAGCAGGATGCAGAGCT IL-12/23 P40 Forward TGTGCTCGTGGCCTGATCCACT Reverse CGCA...
Ngày tải lên : 19/06/2014, 22:20
  • 8
  • 447
  • 0
Báo cáo hóa học: " Motavizumab, A Neutralizing Anti-Respiratory Syncytial Virus (Rsv) Monoclonal Antibody Significantly Modifies The Local And Systemic Cytokine Responses Induced By Rsv In The Mouse Model" potx

Báo cáo hóa học: " Motavizumab, A Neutralizing Anti-Respiratory Syncytial Virus (Rsv) Monoclonal Antibody Significantly Modifies The Local And Systemic Cytokine Responses Induced By Rsv In The Mouse Model" potx

... A. M study design, data analyses, manuscript preparation; SCB data analyses and manuscript review, and MBR performing experiments; JC Luminex data analysis and interpretation PK and HSJ data interpretation; ... control antibody, MEDI-507, at the same time of the administration of the anti -RSV antibody had no effect on the cytokine profile or other clinical and inflam...
Ngày tải lên : 20/06/2014, 01:20
  • 5
  • 562
  • 0
báo cáo hóa học:" Microarray analysis of Foxl2 mediated gene regulation in the mouse ovary derived KK1 granulosa cell line: Over-expression of Foxl2 leads to activation of the gonadotropin releasing hormone receptor gene promoter" pptx

báo cáo hóa học:" Microarray analysis of Foxl2 mediated gene regulation in the mouse ovary derived KK1 granulosa cell line: Over-expression of Foxl2 leads to activation of the gonadotropin releasing hormone receptor gene promoter" pptx

... al.: Microarray analysis of Foxl2 mediated gene regulation in the mouse ovary derived KK1 granulosa cell line: Over-expression of Foxl2 leads to activation of the gonadotropin releasing hormone receptor ... resulted in finding a total of 42 genes common to both (Additional file 10) In order to begin to understand the signif...
Ngày tải lên : 20/06/2014, 07:20
  • 12
  • 561
  • 0
Báo cáo y học: "Eotaxin and FGF enhance signaling through an Extracellular signal-related kinase (ERK)-dependent pathway in the pathogenesis of Eosinophilic Esophagitis" doc

Báo cáo y học: "Eotaxin and FGF enhance signaling through an Extracellular signal-related kinase (ERK)-dependent pathway in the pathogenesis of Eosinophilic Esophagitis" doc

... as: Huang et al.: Eotaxin and FGF enhance signaling through an Extracellular signal-related kinase (ERK)-dependent pathway in the pathogenesis of Eosinophilic Esophagitis Allergy, Asthma & Clinical ... AP, TN, and SS aided in the immunohistochemistry VS, CN, AQ, DB, WB, KC, JK, JP, and LN and KN aiding in obtaining biopsy and blood samples NR a...
Ngày tải lên : 08/08/2014, 21:20
  • 9
  • 243
  • 0
Báo cáo y học: "Direct Toll-like receptor 2 mediated co-stimulation of T cells in the mouse system as a basis for chronic inflammatory joint disease" ppsx

Báo cáo y học: "Direct Toll-like receptor 2 mediated co-stimulation of T cells in the mouse system as a basis for chronic inflammatory joint disease" ppsx

... 5'-AGC CGG AAG GTT ATT GTG GTA GT-3' mTLR4 lower 5'-TGC CGT TTC TTG TTC TTC CTC T- 3' mTLR6 upper 5'-ATA CCA CCG TTC TCC ATT T- 3' mTLR6 lower 5'-GAC GTG CTC TAT CAT CAG TG-3' FACS sorting, by using ... inflamed joint activated and memory T cells can pass endothelial barriers TLR ligands can activate T cells independent of antigenic specificity release of inflammatory cytoki...
Ngày tải lên : 09/08/2014, 01:23
  • 14
  • 505
  • 0
Báo cáo khoa học: "Light-dependent changes in the glutathione content Norway spruce (Picea abies (L.) Karst.)" pptx

Báo cáo khoa học: "Light-dependent changes in the glutathione content Norway spruce (Picea abies (L.) Karst.)" pptx

... Enclosing branches in the bag within the period of increasing glutathione concentrations resulted in an immediate decrease in the glutathione content of the needles; when the bag was removed, the glutathione ... rhythm in the glutathione concentration of spruce needles is superimposed on the seasonal changes This result is surprising, since one during spr...
Ngày tải lên : 09/08/2014, 03:24
  • 5
  • 251
  • 0
Báo cáo khoa hoc:" Quantitative Trait Loci (QTLs) mapping for growth traits in the mouse: A review" pot

Báo cáo khoa hoc:" Quantitative Trait Loci (QTLs) mapping for growth traits in the mouse: A review" pot

... associated with individual markers had values between 0.3% and 0.7% In most cases, the alleles that increase the value of a trait at a particular locus in the mapping cross come from the parental ... of loci regulating a given trait [41] According to that model, the number of loci involved in the regulation of a quantitative trait is a function of th...
Ngày tải lên : 09/08/2014, 18:21
  • 28
  • 259
  • 0

Xem thêm