HEPATOCYTE GROWTH FACTOR IS a MAJOR CYTOKINE FOR NSC HOMING TO GLIOMA

HEPATOCYTE GROWTH FACTOR IS a MAJOR CYTOKINE FOR NSC HOMING TO GLIOMA

HEPATOCYTE GROWTH FACTOR IS a MAJOR CYTOKINE FOR NSC HOMING TO GLIOMA

... therefore appears to induce stem cell transmigration across an endothelial barrier [53] In addition, HMGB1 acts as a pro-inflammatory factor, and is released by damaged cells as a chemoattractant ... migration It is suggested that glioma modulated ECM may act as a local guidance for NSC homing in addition to other growth factors or signaling pathways [72] Glioma- pro...

Ngày tải lên: 09/09/2015, 08:17

128 211 0
Tài liệu Báo cáo khoa học: Diol dehydratase-reactivating factor is a reactivase – evidence for multiple turnovers and subunit swapping with diol dehydratase pdf

Tài liệu Báo cáo khoa học: Diol dehydratase-reactivating factor is a reactivase – evidence for multiple turnovers and subunit swapping with diol dehydratase pdf

... reactivating factors – that is, subunit swapping might occur However, no biochemical evidence for this has been obtained so far A similar reactivating factor for ethanolamine ammonia lyase has been ... responsible for the reactivation of the inactivated holoenzymes of DD [1 5–1 7] and glycerol dehydratase [1 8–2 0] were found, and designated DD-reactivating fac...

Ngày tải lên: 15/02/2014, 01:20

13 621 0
def (digestive organ expansion factor) is a crucial gene for the development of endoderm derived organs in zebrafish (danio rerio

def (digestive organ expansion factor) is a crucial gene for the development of endoderm derived organs in zebrafish (danio rerio

... def (digestive- organ expansion factor) IS A CRUCIAL GENE FOR THE DEVELOPMENT OF ENDODERM- DERIVED ORGANS IN ZEBRAFISH (Danio rerio) RUAN HUA (M.Sc., Wuhan University, P.R.China) A THESIS SUBMITTED ... before reviewing zebrafish intestine, liver and pancreas organogenesis 1.3.1 Endoderm formation in zebrafish 1.3.1.1 Endoderm formation and...

Ngày tải lên: 11/09/2015, 16:06

199 297 0
Tài liệu Báo cáo khoa học: TMPRSS13, a type II transmembrane serine protease, is inhibited by hepatocyte growth factor activator inhibitor type 1 and activates pro-hepatocyte growth factor pdf

Tài liệu Báo cáo khoa học: TMPRSS13, a type II transmembrane serine protease, is inhibited by hepatocyte growth factor activator inhibitor type 1 and activates pro-hepatocyte growth factor pdf

... template control A5 49 Protease TMPRSS13 is inhibited by HAI -1 TMPRSS13 HAI -1 HAI-1B HAI -1 GAPDH Fig RT-PCR analysis of TMPRSS13 and HAI -1 mRNA in human carcinoma cell lines Total RNA was isolated ... Tsubouchi H, Naka D, Takahashi K, Okigaki M, Arakaki N, Nakayama H, Hirono S, Sakiyama O, Takahashi K et al (19 89) Molecular cloning and sequence analysis of cDNA for human...

Ngày tải lên: 15/02/2014, 01:20

13 641 0
Báo cáo khoa học: Hepatocyte growth factor activator is a serum activator of single-chain precursor macrophage-stimulating protein potx

Báo cáo khoa học: Hepatocyte growth factor activator is a serum activator of single-chain precursor macrophage-stimulating protein potx

... Kataoka H, Miyata S, Uchinokura S & Itoh H (2003) Roles of hepatocyte growth factor (HGF) activator and HGF activator inhibitor in the pericellular activation of HGF/scatter factor Cancer Metastasis ... for activation of hepatocyte growth factor Structural similarity of the protease precursor to blood coagulation factor XII J Biol Chem 268, 10024–10028 Hayashi T,...

Ngày tải lên: 29/03/2014, 23:20

10 367 0
Báo cáo khoa học: Hepatocyte growth factor activator (HGFA): a serine protease that links tissue injury to activation of hepatocyte growth factor pdf

Báo cáo khoa học: Hepatocyte growth factor activator (HGFA): a serine protease that links tissue injury to activation of hepatocyte growth factor pdf

... S, Sakiyama O, Takahashi K, Miyazaki H, Hashimoto S & Daikuhara Y (1988) Purification and partial characterization of hepatocyte growth factor from plasma of a patient with fulminant hepatic failure ... Hepsin activates pro -hepatocyte growth factor and is inhibited by hepatocyte growth factor Hepatocyte growth factor activator 19 20 21 22 23 24 25 26 27 28 29 30...

Ngày tải lên: 15/03/2014, 11:20

7 502 0
Báo cáo khoa học: Syndecan-4 is a signaling molecule for stromal cell-derived factor-1 (SDF-1)/ CXCL12 pptx

Báo cáo khoa học: Syndecan-4 is a signaling molecule for stromal cell-derived factor-1 (SDF-1)/ CXCL12 pptx

... Glycan and glycosaminoglycan binding properties of stromal cell-derived factor (SDF) -1alpha Glycobiology 10, 21– 29 34 Valenzuela-Fernandez A, Palanche T, Amara A, Magerus A, Altmeyer R, Delaunay ... SDF-1-unstimulated and stimulated HeLa cells were treated with a 1941 Syndecan-4 is an auxiliary receptor for SDF-1 /CXCL12 N Charnaux et al A C B Fig Heparan sulfate is invo...

Ngày tải lên: 16/03/2014, 18:20

15 423 0
Báo cáo sinh học: "Safety and pharmacokinetics of recombinant human hepatocyte growth factor (rh-HGF) in patients with fulminant hepatitis: a phase I/II clinical trial, following preclinical studies to ensure safety" ppt

Báo cáo sinh học: "Safety and pharmacokinetics of recombinant human hepatocyte growth factor (rh-HGF) in patients with fulminant hepatitis: a phase I/II clinical trial, following preclinical studies to ensure safety" ppt

... this article as: Ido et al.: Safety and pharmacokinetics of recombinant human hepatocyte growth factor (rh-HGF) in patients with fulminant hepatitis: a phase I/II clinical trial, following preclinical ... Sakiyama O, Takahashi K, Kimoto M, Kawasaki S, Setoguchi M, Tachikawa T, Shin S, Arima T, Daikuhara Y: Levels of the human hepatocyte growt...

Ngày tải lên: 18/06/2014, 19:20

12 567 0
Báo cáo hóa học: " In Situ Loading of Basic Fibroblast Growth Factor Within Porous Silica Nanoparticles for a Prolonged Release" ppt

Báo cáo hóa học: " In Situ Loading of Basic Fibroblast Growth Factor Within Porous Silica Nanoparticles for a Prolonged Release" ppt

... with a length of 155 amino acids and an isoelectric point of 9.6, which makes it stable in a weak basic solution Therefore, NH4OH as a base catalyst for the hydrolysis and condensation reactions ... bFGF-loaded MSNs was around 0.126 mg measured by a 0.001 mg balance Nanoparticles Characterization Mesoporous silica nanoparticles (MSNs) used for encapsulating bFGF were...

Ngày tải lên: 22/06/2014, 00:20

6 307 0
Báo cáo y học: " Hepatocyte growth factor prevents lupus nephritis in a murine lupus model of chronic graft-versus-host disease" ppt

Báo cáo y học: " Hepatocyte growth factor prevents lupus nephritis in a murine lupus model of chronic graft-versus-host disease" ppt

... TGGCTGTTTCTGGCTGTTACTG and AATCAGCAGCGACTCCTTTTCC; IL-4, CCAGCTAGTTGTCATCCTGCTCTTCTTTCTCG and CAGTGATGAGGACTTGGACTCATTCATGGTGC; β-actin, TGTGATGGTGGGAATGGGTCAG and TTTGATGTCACGCACGATTTCC Statistical analysis ... Morishita R, Sugimoto T, Aoki M, Kida I, Tomita N, Moriguchi A, Maeda K, Sawa Y, Kaneda Y, Higaki J, et al.: In vivo transfection of cis element "decoy" against nuclear factor...

Ngày tải lên: 09/08/2014, 08:22

9 463 0
báo cáo khoa học: "Hepatocyte growth factor incorporated chitosan nanoparticles augment the differentiation of stem cell into hepatocytes for the recovery of liver cirrhosis in mice" pptx

báo cáo khoa học: "Hepatocyte growth factor incorporated chitosan nanoparticles augment the differentiation of stem cell into hepatocytes for the recovery of liver cirrhosis in mice" pptx

... al.: Hepatocyte growth factor incorporated chitosan nanoparticles augment the differentiation of stem cell into hepatocytes for the recovery of liver cirrhosis in mice Journal of Nanobiotechnology ... procedure ensured the systemic incorporation of growth factor into the nanoparticles instead of adsorption Nanoparticles having the...

Ngày tải lên: 11/08/2014, 00:23

11 404 0
Báo cáo y học: "Regenerative and fibrotic pathways in canine hepatic portosystemic shunt and portal vein hypoplasia, new models for clinical hepatocyte growth factor treatment" pdf

Báo cáo y học: "Regenerative and fibrotic pathways in canine hepatic portosystemic shunt and portal vein hypoplasia, new models for clinical hepatocyte growth factor treatment" pdf

... Figures 1A and 1B, respectively PPVH Receptor type-II was increased in both CPSS and PPVH (4- and 5-fold, respectively), indicating an increased binding capacity One of the proteolytic enzymes involved ... techniques provided insight into the effects of portal venous hypoperfusion in two canine hepatic diseases; congenital portosystemic shunt (CPSS) without fibrosis and...

Ngày tải lên: 13/08/2014, 13:20

11 267 0
Tài liệu Báo cáo khoa học: Cell surface nucleolin on developing muscle is a potential ligand for the axonal receptor protein tyrosine phosphatase-r ppt

Tài liệu Báo cáo khoa học: Cell surface nucleolin on developing muscle is a potential ligand for the axonal receptor protein tyrosine phosphatase-r ppt

... anti-placental alkaline phosphatase (PLAP) agarose (C) SDS ⁄ PAGE and silver stain of proteins isolated from AP sepharose (lane 1) and FN3d–AP sepharose (lane 2) A protein band of approximately 95 kDa is ... nucleolin, mean that calculations of binding affinity are unrealistic at this stage Nucleolin localization in muscle is analogous to PTPr ligand localization To determine wh...

Ngày tải lên: 19/02/2014, 05:20

14 670 0
Tài liệu Báo cáo khoa học: Cytochrome P450 Cyp4x1 is a major P450 protein in mouse brain doc

Tài liệu Báo cáo khoa học: Cytochrome P450 Cyp4x1 is a major P450 protein in mouse brain doc

... fusion protein in bacteria A probe for RNAase protection for mouse Cyp4x1 was obtained by PCR of brain RNA with primers 4x1-12-pF, 5¢-CATGGACATAAGTCCTTTTCCCTTCCTCCT-3¢, and 4x1-12-pR, 5¢-AAACATAAATTTCGCCATTTCTCCTAG ... microsomal protein (Fig 5D) This suggests that Cyp4x1 is a major brain cytochrome P450 form [23] A Cyp4x1 immunohistochemistry in brain The...

Ngày tải lên: 19/02/2014, 07:20

12 466 0
w