EXPLORING THE ROLE OF PHARMACOKINETIC ALTERATIONS IN TYROSINE KINASE INHIBITORS (TKIS) ASSOCIATED TOXICITIES
... of tyrosine kinase inhibitors 110 5.3.2 Potential effect of enzyme inducer/inhibitor on pharmacokinetics of tyrosine kinase inhibitors 113 5.3.3 Effect of tyrosine kinase inhibitors ... Overcoming tyrosine kinase inhibitors- induced hepatotoxicity 160 6.5.1 Switching tyrosine kinase inhibitors 161 6.5.2 Alternative dosing 161 6.5.3 Reversibility of toxi...
Ngày tải lên: 09/09/2015, 08:14
... 5¢-d(TCAGAAATTAAAGCGG ATGCATTATTTGCATG)-3¢ The upstream primer containing the NdeI restriction site (underlined) was: 5¢-d(GCTAGCATATGAAGCTTAAA AAAATTG)-3¢ and the downstream primer containing the ... value almost 2.5-fold higher than the native cold adapted enzyme (Table 1) The mutant G26 1A /Y2 6 9A exhibits an Ea almost the same as in the case of the native enzy...
Ngày tải lên: 22/02/2014, 04:20
... setting There are data supporting the use of CT perfusion in acute stroke management [11] Relative MTT and absolute CBV are CT perfusion parameters that help define areas of infarct from areas of ... hyperperfusion state during the ictal state has also been shown with SPECT and f-MRI in patients with focal epilepsy [16,17] CT perfusion has the advantages of...
Ngày tải lên: 21/06/2014, 19:20
báo cáo khoa học: " Exploring the role of organizational policies and procedures in promoting research utilization in registered nurses" potx
... factors influencing the use of RBPs among staff nurses in the Canadian province of Newfoundland and Labrador with the specific aim of understanding the role of P&Ps in promoting research utilization ... understanding of the factors that influence nurses' use of RBPs, and the role that P&Ps may play in promoting research utilization in nurses...
Ngày tải lên: 11/08/2014, 05:22
The role of leadership theory in raising the profile of women in management
... in raising the profile of women in management or leadership roles Early leadership theories In the 18th and 19th centuries, philosophers suggested a theory of leadership which was termed the ... although the leadership literature has played a significant role in raising the profile of women in management, further advances are required in...
Ngày tải lên: 08/10/2013, 15:56
Globalization: the Role of Institution Building in the Financial Sector _ The Case Study of China
... globalization II Review of Institution Building in the Financial Sector A Main driving forces of institution building A review of the developments of China s financial sector over the past 20 years reveals ... unique role in institution building in the financial sector They help to mitigate financial repression in China, to establish sound...
Ngày tải lên: 18/10/2013, 07:15
Tài liệu The Role of BCG Vaccine in the Prevention and Control of Tuberculosis in the United States: A Joint Statement by the Advisory Council for the Elimination of Tuberculosis and the Advisory Committee on Immunization Practices docx
... Atlanta, GA 30333 SUGGESTED CITATION Centers for Disease Control and Prevention The role of BCG vaccine in the prevention and control of tuberculosis in the United States: a joint statement by ... Committee and the Advisory Committee for Elimination of Tuberculosis published a joint statement on the use of BCG va...
Ngày tải lên: 15/02/2014, 13:20
Tài liệu The Role of Community Banks in the U.S. Economy pdf
... Reserve therefore has a strong interest in understanding issues facing community banks I THE CURRENT ROLE OF COMMUNITY BANKS The banking system in the United States has always been unique in the ... While community banks still comprise the vast majority of banks, the question arises whether their role in the banking system has declined to the point...
Ngày tải lên: 16/02/2014, 11:20
Tài liệu Báo cáo khoa học: The role of electrostatic interactions in the antitumor activity of dimeric RNases docx
... geometry of the hinge loop after ligation Also in this case no clashes were detected at Electrostatic interactions and antitumor RNases the dimer interface of the models or in the surroundings of the ... the C-terminal and N-terminal structural regions, respectively, of the two A and B monomers of the dimeric RNase The black circle between the monom...
Ngày tải lên: 19/02/2014, 06:20
Tài liệu Báo cáo khoa học: The role of N-glycosylation in the stability, trafficking and GABA-uptake of GABA-transporter 1 Terminal N-glycans facilitate efficient GABA-uptake activity of the GABA transporter pptx
... side-chains are important for the GABA transport activity 1- Deoxymannojirimycin inhibits the GABA- uptake of GAT1 In order to gain further insight into the role of the terminal structures of the N-glycans ... N-glycans, in particular their terminal structures, are involved in regulating the GABA translocation of GAT1, but not in binding of GAT...
Ngày tải lên: 19/02/2014, 17:20
Tài liệu Báo cáo khoa học: "From HOPE en I''''ESPERANCE On the Role of Computational Neurolinguistics in Cross-Language Studies " pptx
... processing approach to comprehension of French, w i l l form the basis of the discussion I t is the in interaction of the results of these asynchronous processes that the process of comprehension ... at any moment of the process are context dependent; they depend on the "current state" of the system The system presents an i n i t i a l attempt to integrate...
Ngày tải lên: 21/02/2014, 20:20
Tài liệu Báo cáo khoa học: "Exploring the Use of Linguistic Features in Domain and Genre Classification" potx
... assigned the class of the majority of the items which reached it during training The trees were grown using recursive partitioning; the splitting criterion was reduction in deviance Using the Gini index ... texts of argumentative types The frequency of infinitives of auxiliaries reflects both the use of passive voice, which is formed with the auxiliary "war-...
Ngày tải lên: 22/02/2014, 03:20
Enterprise Adjustment and the Role of Bank Credit in Russia: Evidence from a 420 Firm''''s Qualitative Survey pdf
... good enterprises, they appear unable to ration bad ones Enterprise Adjustment and the Role of Bank Credit in Russia: Evidence from a 420 Firm's Qualitative Survey ENTERPRISE ADJUSTMENT AND THE ROLE ... Enterprise Adjustment and the Role of Bank Credit in Russia: Evidence from a 420 Firm's Qualitative Survey In 1996,...
Ngày tải lên: 06/03/2014, 08:20
BEYOND MICROCREDIT: THE ROLE OF SAVINGS BANKS IN MICROFINANCE potx
... CHARACTERISTICS OF MICROFINANCE This edition of Perspectives analyses the role of savings banks and WSBI members in microfinance. 1 The first section discusses microfinance in general The second section ... Report Microfinance Services by Savings Banks in Africa – The Sleeping Giants have started moving, but where are they going? 2.1 Summary 2.2 Main chara...
Ngày tải lên: 06/03/2014, 10:20