Projection based spatial augmented reality for interactive visual guidance in surgery

Projection based spatial augmented reality for interactive visual guidance in surgery

Projection based spatial augmented reality for interactive visual guidance in surgery

... PROJECTION- BASED SPATIAL AUGMENTED REALITY FOR INTERACTIVE VISUAL GUIDANCE IN SURGERY WEN RONG (B.Eng., M.Sc., Chongqing University, Chongqing, China) A THESIS SUBMITTED FOR THE DEGREE ... contact infection In addition, this study explores projection- based X visualization for robot-assisted needle insertion Operation of the surgical robot was integrated into th...

Ngày tải lên: 08/09/2015, 19:24

164 732 0
Báo cáo hóa học: " Classification-Based Spatial Error Concealment for Visual Communications" pptx

Báo cáo hóa học: " Classification-Based Spatial Error Concealment for Visual Communications" pptx

... the detailed encoding method for side information, we denote the side information for the GSB concealment method as “0” and that for OASI as “1.” The side information for all blocks can be put together ... Attaching side information to image stream Channel coding Side information Error concealment by method Performance comparison Source coding Transmitting Channel coding Error...

Ngày tải lên: 22/06/2014, 22:20

17 274 0
báo cáo hóa học:" Research Article Augmented Reality for Art, Design and Cultural Heritage—System Design and Evaluation" doc

báo cáo hóa học:" Research Article Augmented Reality for Art, Design and Cultural Heritage—System Design and Evaluation" doc

... AR system performs also in qualitative sense, we tested it with artists and designers in various art, design, and cultural heritage projects The application of artists and designers and curators ... Visualization Techniques for Art and Design (2006-2007) and Interactive Visualization Techniques for Art and Design (2007–2009) The authors thank all artists, designers,...

Ngày tải lên: 21/06/2014, 20:20

16 383 0
Báo cáo hóa học: " Research Article An Attention-Information-Based Spatial Adaptation Framework for Browsing Videos via Mobile Devices" pptx

Báo cáo hóa học: " Research Article An Attention-Information-Based Spatial Adaptation Framework for Browsing Videos via Mobile Devices" pptx

... It is this analysis that motivated us to design an attention-information-based spatial adaptation framework for browsing video via mobile devices This intelligent design of spatial adaptation ... For sequences of Table, Football, Tempete, Paris, Stefan, and Mobile, there are virtually no performance loss with our approach while for the sequences of Foreman and Coast...

Ngày tải lên: 22/06/2014, 19:20

12 278 0
Fuzzy AHP based decision support system for selecting ERP systems in textile industry by using balanced scorecard

Fuzzy AHP based decision support system for selecting ERP systems in textile industry by using balanced scorecard

... (1985) Fuzzy hierarchical analysis Fuzzy Sets Systems, 17(1), 233–247 Buckley, J J (1985) Ranking alternatives using fuzzy numbers Fuzzy Sets Systems, 15(1), 21–31 Byun, D (2001) The AHP approach for ... world textile and clothing industry The Turkish clothing industry is the fourth largest supplier in the world, and the second largest supplier in the EU The Turkish...

Ngày tải lên: 07/12/2013, 11:41

10 506 1
Báo cáo khoa học: A fluorescence energy transfer-based mechanical stress sensor for specific proteins in situ pdf

Báo cáo khoa học: A fluorescence energy transfer-based mechanical stress sensor for specific proteins in situ pdf

... 5Â-CCTGGATTTTCTGACCAATTTTT TTAAGTCGTAAGCGCTTGCGC-3Â; 2.5I sense primer, 5Â-GAAACAAGATTAAAGAAAAGAAAATTTAGAAAC AAGATTAAAGAAAAGCTTAAAAAAATTGGTCAGA AAATC-3Â; 2.5I antisense primer, 5Â-GATTTTCTGAC CAATTTTTTTAAGCTTTTCTTTAATCTTGTTTCTAA ... claim to original US government works F Meng et al AAAATTTAGAAACAAGATTAAAGAAAAGCTTAAA AAAATTGGTCAGAAAATCCAGGGTTTCGTGCCGAA ACTTGCAGGTGT-3Â, was synthesized by Oper...

Ngày tải lên: 30/03/2014, 04:20

16 329 0
Báo cáo khoa học: "The efficacy of preoperative PET/CT for prediction of curability in surgery for locally advanced gastric carcinoma" ppsx

Báo cáo khoa học: "The efficacy of preoperative PET/CT for prediction of curability in surgery for locally advanced gastric carcinoma" ppsx

... below 130 mg/mL and rested for approximately 45 minutes before receiving an intravenous injection of 440 MBq of 18F-FDG Scanning began 60 minutes later A combined PET/CT in- line system (Biograph LSD, ... findings of invasion into the pancreatic head were necessarily defined as non-curative surgery Pancreaticoduodenectomy as a curative surgery for pancreatic invasions of g...

Ngày tải lên: 09/08/2014, 03:22

7 470 0
Tài liệu Báo cáo khoa học: "An ERP-based Brain-Computer Interface for text entry using Rapid Serial Visual Presentation and Language Modeling" ppt

Tài liệu Báo cáo khoa học: "An ERP-based Brain-Computer Interface for text entry using Rapid Serial Visual Presentation and Language Modeling" ppt

... typing interface difficult or impossible to use for the most impaired users Simpler interactions via brain-computer interfaces (BCI) hold much promise for effective text communication for these ... symbols is removed and, like before, the user can take a break and then the system continues with the next epoch Language Modeling Language modeling is important for many text...

Ngày tải lên: 20/02/2014, 05:20

6 551 0
Tài liệu Báo cáo khoa học: "Statistical phrase-based models for interactive computer-assisted translation" pdf

Tài liệu Báo cáo khoa học: "Statistical phrase-based models for interactive computer-assisted translation" pdf

... Annual Conference of the European Association for Machine Translation), pages 30–40, Budapest, Hungary, May Phrase-based models have been used for interactive CAT in this work We show how SMT ... Equation summarizes the following three mat4 Phrase-based models ters to be solved: First, an output language model The usual statistical translation models can be is needed to distin...

Ngày tải lên: 20/02/2014, 12:20

7 308 0
Báo cáo hóa học: " Research Article Feature-Based Image Comparison for Semantic Neighbor Selection in Resource-Constrained Visual Sensor Networks" doc

Báo cáo hóa học: " Research Article Feature-Based Image Comparison for Semantic Neighbor Selection in Resource-Constrained Visual Sensor Networks" doc

... techniques used for image comparison in VSNs and those developed for general Content-Based Image Retrieval (CBIR) systems 2.1 Feature-Based Image Comparison In computer vision terminologies, image feature ... of the feature-based image comparison method; Section concludes this paper This paper studies the feature-based image comparison method for s -neighbo...

Ngày tải lên: 21/06/2014, 08:20

11 331 0
Báo cáo hóa học: " A Conjugate-Cyclic-Autocorrelation Projection-Based Algorithm for Signal Parameter Estimation" pptx

Báo cáo hóa học: " A Conjugate-Cyclic-Autocorrelation Projection-Based Algorithm for Signal Parameter Estimation" pptx

... USA, 1988 [2] V De Angelis, L Izzo, A Napolitano, and M Tanda, “Performance analysis of a conjugate-cyclic-autocorrelation projectionbased algorithm for signal parameter estimation,” in Proceedings ... 2001 [7] A Napolitano and M Tanda, A non-data-aided cyclic-autocorrelation-based algorithm for signal parameter estimation,” in Proceedings of 4th International Symposi...

Ngày tải lên: 22/06/2014, 22:20

7 187 0
Báo cáo y học: "Hawkeye: an interactive visual analytics tool for genome assemblies" pptx

Báo cáo y học: "Hawkeye: an interactive visual analytics tool for genome assemblies" pptx

... Tammi MT, Tran AN, Kindlund E, Andersson B: DNPTrapper: an assembly editing tool for finishing and analysis of complex repeat regions BMC Bioinformatics 2006, 7:155 Xanthamonas oryzæ pv oryzicola ... mis-assembly in repetitive regions Hawkeye is the first analysis tool that enables users to navigate the assembly hierarchy easily, and thus enables a complete and accurate analysis of t...

Ngày tải lên: 14/08/2014, 20:22

12 190 0
An operating system for augmented reality ubiquitous computing environments

An operating system for augmented reality ubiquitous computing environments

... Access point AR - Augmented reality ARAF - Augmented Reality Application Framework ARML - Augmented Reality Markup Language ASCII - American Standard Code for Information Interchange CAD - Computer-aided ... defines an anchor, which is used by viewing devices for detection of the feature, and the visual asset to be augmented An anchor can be a set of GPS coordinates (for...

Ngày tải lên: 09/09/2015, 08:11

160 360 0
An augmented reality based hybrid approach to facility layout planning

An augmented reality based hybrid approach to facility layout planning

... two planning modes utilize human intelligence (manual planning) and the mathematical optimization techniques (automatic planning) to facilitate the layout planning and evaluation processes and ... approach and provides two planning modes, viz., manual planning and automatic planning The use of GMCC provides real-time information to facilitate the manual planning process...

Ngày tải lên: 10/09/2015, 09:03

140 323 0
w