Constructive role of internal noise for the detection of weak signal in cell system

... resonance among the noise, the noise- induced oscillation, and the signal can intensively enhance the ability of the system in detection of the weak signal, especially when the frequency of the signal ... cross-coupling (ICC) cell model, we investigated how the internal noise would influence the detection of weak signal Model The model...

Ngày tải lên: 02/09/2015, 13:20

... examined the role of Chk1, a canonical member of the ATM/ATR pathway, in DNA damage- induced G2 checkpoint control While examining the role of p38 in the G2 checkpoint pathway, we found that inhibition ... many of the key regulators of the cell cycle, including Cdc2/cyclinB complex, now known CDK1 (100) The main goal of cells in the G1 phase...

Ngày tải lên: 11/09/2015, 09:02

... 2000) CDK protein levels remain stable during the cell cycle, in sharp contrast to their activating proteins, the cyclins The oscillatory expression of most cyclin proteins during cell cycle progression ... C-terminus of TRIP- Br2, which includes the putative C-terminal NES of TRIP- Br2, stabilized TRIP- Br2 in G2/M phase 189 Figure 30E Inhibition of nuclear...

Ngày tải lên: 13/09/2015, 20:18

... 5'-AGCGTCTAGCCATGGCGTTAGTAT-3' 74 97 Ba 5'-TCCTCGCAATTCCGGTGTACTC-3' 161 182 Bp FAM5'-CCCCCCTCCCGGGAGAGCCATAGT-3' BHQ 121 144 ICp Cy55'-TTCCGCTGCCTGCTCAGTCGATCC-3' BHQ BHQ: Black Hole Quencher ... LOD of the duplex real-time RT-PCR assay was 38.99 IU/ml and the specificity was 100% Furthermore, the cost of the duplex real-time RT-PCR assay was considerably lower than t...

Ngày tải lên: 12/08/2014, 04:20

... Coronary angiography remains the gold standard for the morphologic diagnosis of CAD and also allows revascularization during the same procedure [12, 13] Coronary angiography is a relatively safe and ... Combined Analysis Total USA Asia Germany female male < 65 years 65+ years Female, < 65 years Female, 65+ years Male, < 65 years Male, 65+ years No Revasc PCI CABG Revasc...

Ngày tải lên: 03/11/2012, 10:58

... Identification of C8-modified deoxyinosine and N2- and C8-modified deoxyguanosine as major products of the in vivo reaction of N-hydroxy-6-aminochrysene with DNA and the formation of the adducts in isolated ... recommend the Ames test using these sensitive strains (especially YG1041 and/ or YG1042) in combination with the standard tester strains (TA98 and TA...

Ngày tải lên: 05/09/2013, 08:40

... Atlanta, GA 30333 SUGGESTED CITATION Centers for Disease Control and Prevention The role of BCG vaccine in the prevention and control of tuberculosis in the United States: a joint statement by ... Committee and the Advisory Committee for Elimination of Tuberculosis published a joint statement on the use of BCG va...

Ngày tải lên: 15/02/2014, 13:20

... al., Critical evaluation of diagnostic aids for the , Oral Oncol (2007), doi:10.1016/j.oraloncology.2007.06.011 ARTICLE IN PRESS Critical evaluation of diagnostic aids for the detection of oral cancer ... al., Critical evaluation of diagnostic aids for the , Oral Oncol (2007), doi:10.1016/j.oraloncology.2007.06.011 ARTICLE IN PRESS Critic...

Ngày tải lên: 06/03/2014, 02:21

... v INTERNATIONAL STANDARD ISO 6579:2002(E) Microbiology of food and animal feeding stuffs — Horizontal method for the detection of Salmonella spp WARNING — In order to safeguard the health of ... Members of ISO and IEC maintain registers of currently valid International Standards ISO 6887-1, Microbiology of food and animal feedin...

Ngày tải lên: 07/03/2014, 16:20

... measured in a ¯owing stream of pure air or in 40 ppm NO in air (60:40 mixture from an air cylinder with another cylinder (BOC special gases) containing ca 100 ppm NO balanced with air) by the ac ... concentration of NO and NO2 gases because of the low concentration, one of the roles of the Ag is apparent to provide surface for the conversion of N...

Ngày tải lên: 19/03/2014, 16:47

... 5'-CCGTAGGCGATGGTCGTCCTAACRAAYTGNGG-3' 5'-TACAAAATACAGCGAGTGATANATRAARCA-3' ORF 59 (RFHV/KSHV)7 5'-TGAAAATCCACAGGCATGAT-3' 1The terminal "a" or "b" in the primer name indicates the plus or minus sense of the gene transcription, ... at the WaNPRC DNA samples were obtained from PBMC of a random assortment of thirty macaques housed at the WaNPRC and analyzed using the...

Ngày tải lên: 18/06/2014, 22:20

... at the WaNPRC DNA samples were obtained from PBMC of a random assortment of thirty macaques housed at the WaNPRC and analyzed using the standard RV2 and OSM QPCR assays While all of the samples ... 5'-CTTGCCAACGATTACATTTCCAGRGAYGARCT-3' 5' CTGGCTAACGACTACATCTCCAGRGAYGARCT-3' 5'-GGCAGTTTCAAGGCTGTGAATTTYTTYGARCG-3' 5'-CCGTAAGAAATGGTGGTCCTGACRAAYTGNGG-3' 5'-CCGTAGGCGATG...

Ngày tải lên: 20/06/2014, 04:20

... guarantee a statistical analysis of the generated data The MCC represents an array of miniaturized cell culture chambers for permanent noninvasive characterization of individual cells in a cell ... microplates, the new miniaturized cell culture chamber enables a fast and sensitive quantification of IL8 promoter activations that is based on the analysi...

Ngày tải lên: 21/06/2014, 00:20

... that a TNAR is available in this latter case A Unknown parameters (µs, φs) and known total noise (R, C) Under the assumptions A1 and A2 , assuming known parameters R, C and s and unknown parameters ... performance In a same way, the O9 detector, which assumes that all the parameters of the sources are unknown, has the lowest performance Moreover, for a...

Ngày tải lên: 21/06/2014, 00:20

... Capture probe 5-GAGGAGGATGAAATAGATGGTCCAGCTGG ACAAGCAGAACCGGACAGAGCCCATTACAATAT TGTAACCTTTTGTTGCAAGTGTGACTCT ACGCTTCGGT-3 Secondary probe 5-GGAGCGACCCAGAAAGTTACCACAGTTATGC ACAGAGCTGCAAACAACTA-3 ... on the basis of the cutoff value Detection of HPV- 16 with QDs and superparamagnetic nanoparticle-based hybridization The rationale of QDs and superparamagnetic nanopartic...

Ngày tải lên: 21/06/2014, 01:20