Exploring the Relevance of Manual Pattern Cutting Skills in a Tchnological Environment, Catherine Pritchard, 2013
... encouraging accurate translation of an idea into a physical garment Manual pattern cutting can be approached using three main methods; Flat pattern cutting, Draping or Modifying (also referred to as ... patterns for mass production it became relevant to the research to ask whether because of the use of hand skills, manual pattern cutting was a craft and was patt...
Ngày tải lên: 15/08/2015, 01:53
... THE DYNAMICS OF LITERARY REPRESENTATION AND INTERPRETATION IN A MULTILINGUAL ENVIRONMENT: A STUDY OF SELECTED MALAYSIAN AND SINGAPORE NOVELS IN ENGLISH ROSALY JOSEPH PUTHUCHEARY (M .A, in English ... language and mother tongues as the second The National Language (Bahasa Kebangsaan) which is standard Malay became gradually the medium of ins...
Ngày tải lên: 16/09/2015, 08:30
... factors influencing the use of RBPs among staff nurses in the Canadian province of Newfoundland and Labrador with the specific aim of understanding the role of P&Ps in promoting research utilization ... understanding of the factors that influence nurses' use of RBPs, and the role that P&Ps may play in promoting research utilization in nurses...
Ngày tải lên: 11/08/2014, 05:22
Báo cáo hóa học: " Modeling the effects of drug resistant influenza virus in a pandemic" doc
... the time point for the importation of the resistant strain is shifted towards the initial phase of the epidemic, the resistant strain increasingly replaces the sensitive strain (Figure 1c) Early ... has been circulating in the population for many years without pandemic potential and leaving the population at least partially immune The implications for avian infl...
Ngày tải lên: 20/06/2014, 01:20
Báo cáo y học: "Occipital peripheral nerve stimulation in the management of chronic intractable occipital neuralgia in a patient with neurofibromatosis type 1: a case report" pot
... Cite this article as: Skaribas et al.: Occipital peripheral nerve stimulation in the management of chronic intractable occipital neuralgia in a patient with neurofibromatosis type 1: a case report ... life With regard to her family medical history, her mother had died at 68 years of age as a result of heart disease, and her father was alive at...
Ngày tải lên: 11/08/2014, 00:23
the management of foreign exchange rate regime in a market-oriented economy
... The official exchange rate also has several types: the interbank exchange rate, exchange rate of commercial banks, accounting exchange rates 1.2.2.2 Nominal and real exchange rate Nominal exchange ... participate in stipulating the exchange rate, have an official exchange rate (listed by the Government) and an unofficial rate, also known as the paralle...
Ngày tải lên: 04/12/2014, 08:49
Báo cáo y học: "Management of chest pain: exploring the views and experiences of chiropractors and medical practitioners in a focus group interview"
... interdisciplinary health care in rural settings J Manipulative Physiol Ther 1996, 19:82-91 Shima MA: Evaluation of chest pain: back to the basics of history taking and physical examination Postgrad Med ... by all three investigators, although two of the study investigators were also present during the focus group Data management and analysis Focus Group Qualitati...
Ngày tải lên: 25/10/2012, 10:06
Tài liệu Gravitational Physics: Exploring the Structure of Space and Time pdf
... reserved Gravitational Physics: Exploring the Structure of Space and Time http://www.nap.edu/catalog/9680.html GRAVITATIONAL PHYSICS: EXPLORING THE STRUCTURE OF SPACE AND TIME ing field of gravitational ... reserved Gravitational Physics: Exploring the Structure of Space and Time http://www.nap.edu/catalog/9680.html 22 GRAVITATIONAL...
Ngày tải lên: 12/02/2014, 16:20
Tài liệu Exploring the challenges of HIV- AIDS docx
... during the implementation phase of the project 11 EXPLORING THE CHALLENGES OF HIV /AIDS Progress in SADC countries The Healthy Relationships intervention component Over the past two years each of the ... Researcher in the office of the CEO at the Human Sciences Research Council in Cape Town At the time of writing, Kristin Roe was a CIDA-funded intern with t...
Ngày tải lên: 18/02/2014, 23:20
Tài liệu SPACE, TIME, FRAME, CINEMA EXPLORING THE POSSIBILITIES OF SPATIOTEMPORAL EFFECTS pdf
... direction Each frame, then, has a minimum width (along the spatial axis) representing the amount of space captured in the frame, due to the field of view of the lens and the width of the frame itself, ... On the far left side of the frame, which is the narrowest, the exposure time is the shortest and the bar is sharpest and has the least amount of...
Ngày tải lên: 19/02/2014, 10:20
Tài liệu space 2030 exploring the future of space applications docx
Ngày tải lên: 21/02/2014, 16:20
Tài liệu Báo cáo khoa học: "Exploring the Use of Linguistic Features in Domain and Genre Classification" potx
... assigned the class of the majority of the items which reached it during training The trees were grown using recursive partitioning; the splitting criterion was reduction in deviance Using the Gini index ... texts of argumentative types The frequency of infinitives of auxiliaries reflects both the use of passive voice, which is formed with the auxiliary "war-...
Ngày tải lên: 22/02/2014, 03:20
Tài liệu Báo cáo Y học: Exploring the role of a glycine cluster in cold adaptation of an alkaline phosphatase pdf
... 5¢-d(TCAGAAATTAAAGCGG ATGCATTATTTGCATG)-3¢ The upstream primer containing the NdeI restriction site (underlined) was: 5¢-d(GCTAGCATATGAAGCTTAAA AAAATTG)-3¢ and the downstream primer containing the ... value almost 2.5-fold higher than the native cold adapted enzyme (Table 1) The mutant G26 1A /Y2 6 9A exhibits an Ea almost the same as in the case of the native enzy...
Ngày tải lên: 22/02/2014, 04:20