In situ soil testing for foundation performance prediction
... seismic in situ testing is capable of providing the essential information required to quantify soil nonlinearities Having made our survey of soil testing techniques and soil models, the following ... pressed -in piles or driven piles, introduce great ranges of stress and strain into the surrounding soil, spanning from in situ stress right down to the normal compression lin...
Ngày tải lên: 13/08/2015, 10:36
... Chapter Introduction The modern information technology consists of three parts: information acquiring, information processing, information transferring and information storage In fact, information ... Exploration of In- Situ Diagnosis Methods for the Evaluation of Mechanical and Magnetic Performance of Hard Disk Drives ZHU JIN (B.Eng (hons) HUST, P....
Ngày tải lên: 05/10/2015, 22:15
... predicting salts transport in fields in China The objective of this study was to examine the change in hydraulic conductivity that occurs as a result of adding the gypsum, and to examine the transport ... the beginning of leaching, decreased after a peak, and then increased and decreased again This behavior indicates that the initial leaching is like Na+ leachi...
Ngày tải lên: 05/09/2013, 09:38
Báo cáo khoa học: "Prediction in Chart Parsing Algorithms for Categorial Unification Grammar" pdf
... bottom-up parser working with a generic rule set There is a Second reason for considering instantiated grammars It is possible in bottom-up parsing to speed up the parsing process by adding topdown prediction ... morphosyntactic information was not completely filtered out A categorial lexicon for German, for instance, containing only determiners, adjectives, nouns, and transitiv...
Ngày tải lên: 18/03/2014, 02:20
Báo cáo " An analysis of soil characteristics for agricultural land use orientation in Thai Thuy District, Thai Binh " pdf
... Duyen, Thuy An, Thuy Chinh, Thuy Dan, Thuy Ninh, Thuy Van, Thuy Binh, Thuy Quynh and Thuy Huong communes, which are inside the dyke Acid sulfate soil has medium mechanic content The local people uses ... 1995 Paddy land (2 crops) Paddy land (2 crops) Bare land Paddy rice - vegetable Paddy land Paddy land Paddy land Mangrove Mangrove Paddy land (2 crops) Paddy...
Ngày tải lên: 28/03/2014, 15:20
Báo cáo khoa học: Identification of a preferred substrate peptide for transglutaminase 3 and detection of in situ activity in skin and hair follicles pdf
... BA & Maki M (20 03) Analysis of epidermaltype transglutaminase (transglutaminase 3) in human stratified epithelia and cultured keratinocytes using monoclonal antibodies J Dermatol Sci 32 , 95–1 03 ... Baxa U & Steinert P (20 03) Roles of calcium ions in the activation and activity of the transglutaminase enzyme J Biol Chem 278, 238 34– 238 41 30 Hitomi K, Presland RB,...
Ngày tải lên: 29/03/2014, 21:20
Báo cáo khoa học: A fluorescence energy transfer-based mechanical stress sensor for specific proteins in situ pdf
... 5Â-CCTGGATTTTCTGACCAATTTTT TTAAGTCGTAAGCGCTTGCGC-3Â; 2.5I sense primer, 5Â-GAAACAAGATTAAAGAAAAGAAAATTTAGAAAC AAGATTAAAGAAAAGCTTAAAAAAATTGGTCAGA AAATC-3Â; 2.5I antisense primer, 5Â-GATTTTCTGAC CAATTTTTTTAAGCTTTTCTTTAATCTTGTTTCTAA ... claim to original US government works F Meng et al AAAATTTAGAAACAAGATTAAAGAAAAGCTTAAA AAAATTGGTCAGAAAATCCAGGGTTTCGTGCCGAA ACTTGCAGGTGT-3Â, was synthesized by Oper...
Ngày tải lên: 30/03/2014, 04:20
Báo cáo sinh học: " Usefulness of Herpes Consensus PCR methodology to routine diagnostic testing for herpesviruses infections in clinical specimens" docx
... the Consensus PCR assay may also be useful for monitoring the efficacy of treatment [20] According to our experience, Consensus PCR assay can be useful to facilitate the routine diagnosis of herpesviruses ... patients clinically not suspected of having herpesviruses CNS infections were positive with the Consensus PCR assay To our knowledge, this is the first...
Ngày tải lên: 18/06/2014, 18:20
báo cáo hóa học: " Screening for tuberculosis and prediction of disease in Portuguese healthcare workers" docx
... study, performed the physical examinations, and was involved in drafting of the paper RS was involved in data collection and drafting of the paper FR was involved in data analysis and drafting of the ... screened in the scope of this study (Table 5) Eight HCWs had active TB at the time of screening, and progression to active TB within to 24 months of screening o...
Ngày tải lên: 20/06/2014, 00:20
Báo cáo hóa học: " Usefulness of Herpes Consensus PCR methodology to routine diagnostic testing for herpesviruses infections in clinical specimens" docx
... the Consensus PCR assay may also be useful for monitoring the efficacy of treatment [20] According to our experience, Consensus PCR assay can be useful to facilitate the routine diagnosis of herpesviruses ... patients clinically not suspected of having herpesviruses CNS infections were positive with the Consensus PCR assay To our knowledge, this is the first...
Ngày tải lên: 20/06/2014, 01:20
Báo cáo hóa học: "Research Article Statistical Real-time Model for Performance Prediction of Ship Detection from Microsatellite Electro-Optical Imagers" docx
... feature for detection and tracking purposes Therefore, wake detection is often used either in combination with or even instead of other ship detection methods A ship produces two types of wakes ... subject of further research Our aim is only to propose a real-time methodology for assessing EO sensor performance and to illustrate this methodology by the design of a si...
Ngày tải lên: 21/06/2014, 19:20
Báo cáo hóa học: " Research Article New Technique for Improving Performance of LDPC Codes in the Presence of Trapping S" doc
... performance in the case of constant error patterns In this paper, we propose a novel approach for enhancing decoder performance in presence of trapping sets by introducing a new concept called trapping ... the dominant trapping sets are formed by a combination of short cycles present in the bipartite graph In the following, we adopt the terminology an...
Ngày tải lên: 21/06/2014, 23:20
Báo cáo hóa học: " A Facile Strategy for In Situ Core-Template-Functionalizing Siliceous Hollow Nanospheres for Guest Species Entrapment" potx
... Benjamin, Z Miklos, Acta Biomater 4, 733 (2008) 38 M Fujiwara, K Shiokawa, K Hayashi, K Morigaki, Y Nakahara, J Biomed Mater Res Part A 8 1A, 103 (2007) 39 M Fujiwara, K Shiokawa, I Sakakura, Y Nakahara, ... polyacrylate sodium (30 wt%, average Mw *2.5 KDa) (abbreviated as PAS2.5) and poly(aspartic acid) (30 wt%, average Mw *5.0 KDa) (abbreviated as PAsp5), gelatin (alkalic-processing; 10 w...
Ngày tải lên: 22/06/2014, 00:20
Báo cáo hóa học: " In Situ Loading of Basic Fibroblast Growth Factor Within Porous Silica Nanoparticles for a Prolonged Release" ppt
... with a length of 155 amino acids and an isoelectric point of 9.6, which makes it stable in a weak basic solution Therefore, NH4OH as a base catalyst for the hydrolysis and condensation reactions ... bFGF-loaded MSNs was around 0.126 mg measured by a 0.001 mg balance Nanoparticles Characterization Mesoporous silica nanoparticles (MSNs) used for encapsulating bFGF were...
Ngày tải lên: 22/06/2014, 00:20
Báo cáo hóa học: " Double In Situ Approach for the Preparation of Polymer Nanocomposite with Multi-functionality" potx
... hydrolyze the organotitanium at a controlled rate (Scheme 1) We have called this a double in situ approach, because the in situ synthesis of the nanoparticle (TiO2) coincides with the in situ polymerization, ... matrix, the diameters are mainly under 100 nm In comparison with fire retarded properties of PET and PET-co-DDP, the performance of the nanoco...
Ngày tải lên: 22/06/2014, 01:20