A Horn Fragment with PTime Data Complexity of Regular Description Logic with Inverse
A Horn Fragment with PTime Data Complexity of Regular Description Logic with Inverse
... operators [A] and A , where A is a finite automaton over alphabet R We call [A] (resp A ) a universal (resp existential) automaton-modal operator Automaton-modal operators were used earlier, among ... assertions of the form A( a) or r (a, b) A knowledge base R, T , A is called a Horn- RegI knowledge base if T is a Horn- RegI TBox and A is a Horn- RegI ABox When T is...
Ngày tải lên: 13/08/2015, 10:00
báo cáo hóa học:" The net cost of incorporating resistance testing into HIV/AIDS treatment in South Africa: a Markov model with primary data" pot
... the three main cost inputs to the model: the cost of a year of first-line treatment; the cost of a year of second-line treatment; and the cost of a resistance assay For the treatment costs, we ... duration on treatment was very small Table indicates the cost and other input parameters used in the analysis Second-line therapy costs nearly tw...
Ngày tải lên: 20/06/2014, 08:20
Báo cáo y học: "The emerging modern face of mood disorders: a didactic editorial with a detailed presentation of data and definitions" potx
... Fountoulakis, The emerging modern face of mood disorders: a didactic editorial with a detailed presentation of data and definitions Annals of General Psychiatry 2010, 9:14 Page 22 of 22 ... especially true during the teenage and early adult years, relates mainly to cyclothymia and probably represents attempts at self-medication for the mood liability...
Ngày tải lên: 08/08/2014, 23:21
Báo cáo y học: " Relationship of compartment-specific structural knee status at baseline with change in cartilage morphology: a prospective observational study using data from the osteoarthritis initiative" pps
... cartilage plates from a sagittal data set in a different person: The femoro-tibial cartilages are labeled with the same colors as in (c), the patellar cartilage is labeled magenta and the trochlear ... that may potentially result from small imaging artifacts Analysis of variance (ANOVA) was used first to test whether categorical features of structural knee...
Ngày tải lên: 09/08/2014, 14:21
Ant functional group succession dynamics correlates with the age of vegetation succession data analysis of worldwide studies and a case study of a secondary tropical rain forest in singapore
... FOREST OF SINGAPORE Introduction The main island of Singapore is located off the southern tip of the Malay Peninsula and most of the island consisted of tropical lowland rain forest for much of the ... demonstrated this pattern of functional group succession by conducting a study of the ant community within a secondary tropical rain...
Ngày tải lên: 29/09/2015, 13:01
Báo cáo y học: "The Diels-Alder-Reaction with inverse-Electron-Demand, a very efficient versatile Click-Reaction Concept for proper Ligation of variable molecular Partners"
... study reveals the kinetic pathway for an interfacial reaction Journal of the American Chemical Society 2004; 126: 15613-7 Pozsgay V, Vieira NE, Yergey A A method for bioconjugation of carbohydrates ... ring systems are commercially available or are easily to prepare By this means a wide range of dienophilic compounds is available for DARinv In order to obtain reaction times in...
Ngày tải lên: 26/10/2012, 09:39
A new approach to semantic and syntactic functions of English adjectives – A contrastive analysis with their Vietnamese equivalents
... adjectives with the definitions of adjectives and their semantic and syntactic functions of English adjectives Chapter III is a study to a new approach to semantic and syntactic functions of English adjectives ... Graduation paper Declaration Title: A new approach to semantic and syntactic functions of English adjectives...
Ngày tải lên: 10/04/2013, 14:46
An experimental investigation of heat transfer and fluid flow in a rectangular duct with inclined discrete ribs
... rib arrangements on heat transfer and flow behavior in a rectangular rib roughened passage” International Journal of Heat and mass transfer; 123: 675-681, 2001 [6] Lau S.C., McMillin R.D and Han ... studies of augmented heat transfer and friction in asymmetrically heated rectangular ducts with ribs on the heated wall in transverse, inclined, V-continu...
Ngày tải lên: 05/09/2013, 16:10
Time and performance a three part study examining the relationships of job experience, organizational tenure, and age with job performance
... of Job Experience, Organizational Tenure, and Age with Job Performance Michael C Sturman Working Paper 01 – 05 Time and Performance CAHRS WP 01-05 TIME AND PERFORMANCE: A THREE- PART STUDY EXAMINING ... current jobs Analyses As this study examines a sample of employees over the span of their careers, and because the nature of this sample...
Ngày tải lên: 11/09/2013, 11:44
Structural and semantic features of english idioms referring to head and a contrastive analysis with vietnamese idioms
... occurrence of the word "Head" in English and Vietnamese language in general and in idioms in particular 15 Chapter structural and semantic features of English and Vietnamese idioms referring to head ... for learning and teaching English idioms The aim of the thesis in to make learners of English understand the semantic and structural fe...
Ngày tải lên: 20/12/2013, 18:33
Tài liệu Create a New Table with Data from Existing Tables doc
... build the data adapter ' and fill the data table Dim odaResults As _ New OleDb.OleDbDataAdapter("Select * From MyProdAndCat", BuildCnnStr("(local)", "Northwind")) odaResults.Fill(dtResults) Catch ... Figure 6.8 These results are based on a new table created by the SQL string that is displayed Comments You will probably want to go ahead and drop the new table after you are...
Ngày tải lên: 21/01/2014, 12:20
Tài liệu HOW INTERNET PROTOCOL-ENABLED SERVICES ARE CHANGING THE FACE OF COMMUNICATIONS: A LOOK AT VIDEO AND DATA SERVICES ppt
... Today’s hearing is entitled ‘ How Internet Protocol-Enabled Services Are Changing the Face of Communications: A Look at Video and Data Services. ’’ Video and data are the second and third legs of the ... HCOM1 HOW INTERNET PROTOCOL-ENABLED SERVICES ARE CHANGING THE FACE OF COMMUNICATIONS: A LOOK AT VIDEO AND DATA...
Ngày tải lên: 18/02/2014, 00:20
Tài liệu Báo cáo khoa học: Human enhancer of rudimentary is a molecular partner of PDIP46/SKAR, a protein interacting with DNA polymerase d and S6K1 and regulating cell growth docx
... GCGGGATCCCTCAGCCCATTGGAAGGCACC ATAAGAATGCGGCCGCTCAGCTGTCACTCAGCCGCAGCAG GCGGGATCCAACAAGGAAGAACCCCCC ATAAGAATGCGGCCGCTCAGTCTGAGGTGATAACATTCCC GCGGGATCCCTGGACGGGCAGCCGATGAAG ATAAGAATGCGGCCGCTCAAAGCTTGATTTTGAATTCTGT ... GCGGGATCCAACAAGGAAGAACCCCCC ATAAGAATGCGGCCGCTCAAGGCAGCTCGCTCTCCTTTTT GCGGGATCCCTCAGCCCATTGGAAGGCACC ATAAGAATGCGGCCGCTCAAGGCAGCTCGCTCTCCTTTTT GCGGGATCCGTGAATAATCTGCACCCTCGA ATAAGA...
Ngày tải lên: 19/02/2014, 05:20
Tài liệu Báo cáo khóa học: New activities of a catalytic antibody with a peroxidase activity ppt
... S-oxidation of thioanisole As the above results showed that the best system for the S-oxidation of thioanisole associated H2O2 as an oxidant with MP8 as a catalyst in the presence of tBuOH as an ... case, because an oxidative degradation of the catalyst occurred This was shown by a progressive disappearance, in its absorption spectrum, of the soret band at 396 nm that is chara...
Ngày tải lên: 19/02/2014, 12:20